ID: 1169792364

View in Genome Browser
Species Human (GRCh38)
Location 20:9425025-9425047
Sequence AAGACAAAGGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2897
Summary {0: 1, 1: 2, 2: 45, 3: 363, 4: 2486}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169792364_1169792368 -5 Left 1169792364 20:9425025-9425047 CCTTCCTCCTTCTCCTTTGTCTT 0: 1
1: 2
2: 45
3: 363
4: 2486
Right 1169792368 20:9425043-9425065 GTCTTTCATAAAAAAAAAAAAGG 0: 1
1: 3
2: 53
3: 703
4: 6447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169792364 Original CRISPR AAGACAAAGGAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr