ID: 1169793138

View in Genome Browser
Species Human (GRCh38)
Location 20:9432788-9432810
Sequence ACCAGTGACCACAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169793133_1169793138 3 Left 1169793133 20:9432762-9432784 CCTAACACAGCATCACCTCATGG 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1169793138 20:9432788-9432810 ACCAGTGACCACAGGGCAGAAGG 0: 1
1: 0
2: 3
3: 28
4: 271
1169793132_1169793138 15 Left 1169793132 20:9432750-9432772 CCATGTGGTTCTCCTAACACAGC 0: 1
1: 0
2: 2
3: 12
4: 240
Right 1169793138 20:9432788-9432810 ACCAGTGACCACAGGGCAGAAGG 0: 1
1: 0
2: 3
3: 28
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169793138 Original CRISPR ACCAGTGACCACAGGGCAGA AGG Intronic
900280323 1:1863046-1863068 CCCAGTGTCCACAGTGCTGAGGG - Intronic
900602818 1:3510279-3510301 GCCAGTGACCTCAGGCCAGAGGG + Intronic
902230465 1:15024150-15024172 ACCAATGCCCAGAGGTCAGAAGG + Intronic
902338185 1:15765796-15765818 ACCCGAGGCCACAGGGCAGGTGG - Intronic
903009702 1:20320891-20320913 ACCAGAGGCCACAGCCCAGACGG - Intronic
906607761 1:47183488-47183510 CCCTGTGCCCACAGGGCAGCTGG - Intergenic
907501342 1:54883772-54883794 ACCTGCAACCACAGGACAGAGGG + Exonic
909821362 1:80066244-80066266 ACTACAGACCACAGGCCAGAAGG - Intergenic
911384065 1:97152939-97152961 ACCATTAACTACATGGCAGAGGG - Intronic
913966547 1:143381742-143381764 ACCTGGGAGCACAGAGCAGAGGG + Intergenic
914060922 1:144207349-144207371 ACCTGGGAGCACAGAGCAGAGGG + Intergenic
914118228 1:144759020-144759042 ACCTGGGAGCACAGAGCAGAGGG - Intergenic
914352577 1:146853348-146853370 ACCATGGACCACTGGGCCGAGGG + Intergenic
915277927 1:154802444-154802466 TTCAGTGACCTCAGGGCAGCTGG + Intronic
916220608 1:162440988-162441010 ACCAGGGACAGCAGGGCAGATGG + Intergenic
917133884 1:171769393-171769415 AACAGCAACCACAGAGCAGATGG - Intergenic
918332664 1:183474037-183474059 CCCAGTGACCACAGGACAGTTGG + Intronic
921600883 1:217105170-217105192 ACCAGTCACCACAAGGCCAAAGG - Intronic
921670568 1:217919732-217919754 ACCACAGCCCACAGGGCAGACGG - Intergenic
921829642 1:219712252-219712274 ACAAGTGCCCACAGGCTAGAGGG + Intronic
922037857 1:221866770-221866792 TCCAGTGCCCACAAGGCATATGG - Intergenic
922324509 1:224515837-224515859 ATCAGTGACCACAAGTCACAGGG - Intronic
924314019 1:242776932-242776954 ACCTGTGACCTGAGAGCAGAGGG + Intergenic
1067777043 10:49171350-49171372 AGCAGAGAGCAGAGGGCAGAGGG + Intronic
1068050086 10:51939326-51939348 ACCAATCACAACAAGGCAGAAGG - Intronic
1068924146 10:62517393-62517415 ACAAGAGAGCACAGGCCAGAGGG - Intronic
1069346675 10:67477725-67477747 ACCAGTGACTACAGATGAGAAGG + Intronic
1070037529 10:72741589-72741611 GCCACTGACCACAGGGAACATGG - Intronic
1073060230 10:100729544-100729566 ACCGGTGTCCCCAGGCCAGAGGG - Intergenic
1073576958 10:104634395-104634417 ACCTATAACCACTGGGCAGATGG + Intergenic
1075797885 10:125134355-125134377 AGCAGAGACAACAGGGCAGGAGG + Intronic
1075816872 10:125271434-125271456 ACAAGTGTCCAAAGGGGAGAAGG + Intergenic
1076441217 10:130482584-130482606 GGCAGGGACCACAGGGCATATGG + Intergenic
1076568152 10:131412819-131412841 ACCAAACACCACAGGCCAGAGGG - Intergenic
1076577009 10:131476025-131476047 ACGTGTGACCTCAGGGCACAAGG + Intergenic
1077409549 11:2397113-2397135 CCCTGGGACCCCAGGGCAGAAGG - Exonic
1078191026 11:9092216-9092238 ACCAGTGCCCTCAGGGCTGTGGG - Intronic
1078338892 11:10485115-10485137 ACAGGGGACCCCAGGGCAGAGGG - Intronic
1078530067 11:12130382-12130404 ATCAGAGGCCACAGGGCAGAGGG + Intronic
1078758402 11:14232878-14232900 AGCAGTGAGCACATGGCAGGGGG + Intronic
1080246612 11:30186204-30186226 ACCCCTTACCACATGGCAGAAGG + Intergenic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1083381030 11:62268690-62268712 ATCAGAGACCAGAGGGCAGATGG - Intergenic
1084204140 11:67581736-67581758 ACAAAAGATCACAGGGCAGAAGG - Intergenic
1084321368 11:68375233-68375255 ATCACTGACCCCAGGGCACACGG - Intronic
1085038789 11:73314863-73314885 ATCAGGGACCTGAGGGCAGAAGG - Intronic
1085708713 11:78810109-78810131 ACCAGTTAGCATAGAGCAGAGGG + Intronic
1089742685 11:120595768-120595790 AGCAGTGTCCCCAGGGCACATGG - Intronic
1089753313 11:120667364-120667386 ATCAGTGGCCACAGGGAGGAAGG - Intronic
1090477553 11:127037264-127037286 AACAGCCACCACAGGGCTGAAGG - Intergenic
1090958024 11:131530948-131530970 ACCAGTGAGCACAGAGATGATGG + Intronic
1091227391 11:133965825-133965847 ACCACATCCCACAGGGCAGATGG - Intergenic
1091859346 12:3765426-3765448 CCCAATGACAACAGGACAGAGGG + Intergenic
1091959734 12:4683210-4683232 AACAGTTACCTCAGGGCAGTAGG - Intronic
1092001555 12:5036799-5036821 ACATGTTACCACATGGCAGAAGG + Intergenic
1092237944 12:6821640-6821662 GCCAGTGAGCCCAGGCCAGAGGG - Exonic
1100109501 12:91221823-91221845 ACCACTGAACAGAAGGCAGAAGG - Intergenic
1100224077 12:92538809-92538831 AACAGTGAATACAGGGTAGAGGG - Intergenic
1101910762 12:108858654-108858676 ATGAGGGACCACGGGGCAGAGGG + Intergenic
1102205335 12:111086657-111086679 ACAAGTGGCCAAAGGGCATATGG - Intronic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1104801792 12:131559525-131559547 ACCAGTGACCTCAGCGCTGCTGG - Intergenic
1106354932 13:28972376-28972398 ACCTGCGAACACAGTGCAGAAGG - Intronic
1107559635 13:41547575-41547597 ACCACAGTGCACAGGGCAGAGGG - Intergenic
1110272343 13:73604926-73604948 ACAAATGGCCCCAGGGCAGATGG + Intergenic
1110562423 13:76923542-76923564 ACCAGAGACCAGGGGCCAGAAGG + Intergenic
1113338138 13:109396426-109396448 TGCTGTGACCACAGGGCAGGAGG + Intergenic
1113896630 13:113768637-113768659 ACCAGTGACCCCTGCTCAGACGG - Intronic
1118883838 14:69850487-69850509 GCCAGGGACCACAGTGCAGCTGG + Intergenic
1119613838 14:76085362-76085384 TGGAGTGACCACAGAGCAGAGGG + Intergenic
1120887950 14:89466664-89466686 ACCAGGGACCACAGGCTACAAGG + Intronic
1121252549 14:92510769-92510791 ATCAGTGTCCTCAGGACAGATGG - Intergenic
1121813278 14:96910327-96910349 ACCAGTGCCCAGAAGGCACATGG - Intronic
1121822463 14:96982535-96982557 ACCTGTGACCTCAAGGCAGTTGG + Intergenic
1122130162 14:99600411-99600433 ATCAGTGACCATTGAGCAGATGG - Intronic
1122536016 14:102463558-102463580 AGCAGTTACCTCAGGGTAGAGGG + Intronic
1122855044 14:104556079-104556101 AGCTGTGACCCCAGGGCAGATGG - Intronic
1124072274 15:26406501-26406523 CTCAGTGACCACATGGCAGGAGG - Intergenic
1124232390 15:27956677-27956699 ACCAGTGTCCTCAGGCCACAGGG - Intronic
1124350016 15:28948340-28948362 ACCAGTGGCCAAAGGGAAGAAGG - Intronic
1124798156 15:32803054-32803076 ACCTGTGAAAGCAGGGCAGATGG + Intronic
1126160154 15:45604373-45604395 ACCAGGAACTACTGGGCAGATGG - Intronic
1130026487 15:80275340-80275362 ACCAGTGCCAACAGGGCTGAAGG + Intergenic
1131008411 15:88997447-88997469 GCCAGAGACAAAAGGGCAGAAGG - Intergenic
1131176020 15:90210279-90210301 ACCAGACCCCACAGTGCAGAAGG - Intronic
1132872109 16:2119865-2119887 ACCAGGGAGCACAGGGGAGCAGG + Intronic
1132939537 16:2499996-2500018 AACAGTGTCCCCAGGGCAGGCGG - Intronic
1133091822 16:3410835-3410857 ACCAGTCACCTCAGGGCTGTGGG + Intronic
1133594998 16:7282528-7282550 ACCAGAGAACAGAGAGCAGAAGG - Intronic
1134057532 16:11180016-11180038 ACCAGTGACCAGAGAGGTGAGGG - Exonic
1134520416 16:14917031-14917053 ACCAGGGAGCACAGGGGAGCAGG - Intronic
1134551159 16:15138943-15138965 ACCAGGGAGCACAGGGGAGCAGG + Intronic
1134715303 16:16355715-16355737 ACCAGGGAGCACAGGGGAGCAGG - Intergenic
1134959454 16:18396444-18396466 ACCAGGGAGCACAGGGGAGCAGG + Intergenic
1135323770 16:21513196-21513218 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1135573017 16:23563743-23563765 ACAGGGGACCACAGGGCAAACGG - Intronic
1136036542 16:27544823-27544845 ACCCGTGACCCCAGTGAAGAAGG + Intronic
1136228590 16:28874273-28874295 CTCAGTGCCCACAGGCCAGAGGG + Intergenic
1136335253 16:29606461-29606483 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1137762293 16:50950459-50950481 CCCAGAAACCACAGGACAGAAGG + Intergenic
1138341584 16:56292997-56293019 ACCACTGACCACAGGGGAGTTGG - Intronic
1138438353 16:57019563-57019585 GTCAGTGAGCACAGGGCAGATGG + Intronic
1138776497 16:59729775-59729797 ACCAGTGGCCACAGGGCTGGAGG - Intronic
1139208537 16:65053173-65053195 TCCAGTTACCACCGAGCAGATGG + Intronic
1139981452 16:70862171-70862193 ACCATGGACCACTGGGCCGAGGG - Exonic
1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG + Intergenic
1141829352 16:86501080-86501102 CCCAGGGGCCACAGAGCAGATGG + Intergenic
1142007979 16:87699139-87699161 ACCAGAGGCCCCGGGGCAGAGGG - Intronic
1142035978 16:87862303-87862325 AGCAGTGACCAGAGAGCAGAGGG - Intronic
1142080488 16:88146430-88146452 ACCCGGGTCCACAGGGAAGAAGG - Intergenic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1142325217 16:89410547-89410569 AGCAGTAAGCAGAGGGCAGAGGG - Intronic
1143178144 17:4968237-4968259 GCCACTGACCTCAGGGCCGAAGG - Exonic
1144342241 17:14319407-14319429 AACAGTGGACACAGGGAAGAGGG + Intronic
1144707743 17:17380648-17380670 ACCAGGGCCCACAGTGCCGAGGG - Intergenic
1145037503 17:19551552-19551574 ACCAGGGACCCCAGGGTGGAGGG + Intronic
1145256214 17:21323869-21323891 AACGGTAACCACGGGGCAGAAGG - Intergenic
1145320401 17:21764081-21764103 AACGGTAACCACGGGGCAGAAGG + Intergenic
1146522588 17:33537724-33537746 TCCAAGGACCACAGGGCAAAGGG + Intronic
1147326541 17:39672406-39672428 ACCAGGGACCACAGGCCTTAGGG - Exonic
1149525094 17:57349223-57349245 AGCAGTGACCAAAAGGGAGAAGG - Intronic
1149682678 17:58517137-58517159 ACCTGTGATCAGAGGGCAGCAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150584519 17:66505317-66505339 ACCTCTGGCCACAGGGAAGAGGG + Intronic
1154106381 18:11527338-11527360 ACCTGTGAACACAGGACACAGGG + Intergenic
1154356817 18:13627837-13627859 AGCGGTGGCCAGAGGGCAGACGG + Intronic
1155489845 18:26389742-26389764 CCCAGTGACCAGAGGGTAGTGGG + Intronic
1155806246 18:30175123-30175145 ACCAGGCACCACAGAGCAGGCGG + Intergenic
1157431068 18:47627137-47627159 ACTTGTGCCAACAGGGCAGAAGG - Intergenic
1157503594 18:48208929-48208951 AACAGTGAGCACAGGACAGATGG - Intronic
1157863642 18:51162728-51162750 AGCAGTGGCCACACTGCAGATGG + Intergenic
1158299465 18:56035248-56035270 ACTAGAGACCAGAGGCCAGAAGG - Intergenic
1158996501 18:62925894-62925916 CCCAGTGACTCCAGTGCAGATGG + Intronic
1160656741 19:276327-276349 AGAATTGACCACAGAGCAGAAGG + Intergenic
1160954618 19:1684885-1684907 ACCAGTGCAGACAGGGCAGGGGG - Intergenic
1161129242 19:2578646-2578668 CCCAATGTCCACAGGGCTGAGGG - Intronic
1161142271 19:2654781-2654803 CCCAATGTCCACAGTGCAGAGGG - Intronic
1161237066 19:3203587-3203609 CCCAGTGTCCACAGGGCCGAGGG + Intronic
1161481120 19:4511149-4511171 ACCAGTGACTCCACTGCAGACGG + Exonic
1161481417 19:4512634-4512656 ACCAGTCACCCCACTGCAGACGG + Exonic
1161535368 19:4816136-4816158 TCCACTGTCCACAGGGCACAGGG + Exonic
1161719291 19:5894342-5894364 ACCAGAGCCCACAGCGCTGAGGG + Intronic
1161861692 19:6802621-6802643 ACCAGAGACAATAGAGCAGATGG - Intronic
1162496932 19:11028629-11028651 ATCAGGGACCGCAGGGCAGGGGG - Intronic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1162958483 19:14112834-14112856 AGCAGTGCCCACTGGGCAGAGGG + Intronic
1163740782 19:19010519-19010541 AAGAGTGACCACAGGGCAATCGG + Intronic
1164462080 19:28457531-28457553 ACCAGAAGCCAGAGGGCAGAGGG + Intergenic
1165048596 19:33126419-33126441 ACAAGACAGCACAGGGCAGACGG - Intronic
1165279680 19:34785508-34785530 ACCAGAGAGCAGGGGGCAGAAGG - Intergenic
1166315314 19:41986034-41986056 CCCAGTGACCCCCAGGCAGAGGG - Intronic
1167511515 19:49897615-49897637 ATGAGTGACCACCCGGCAGAGGG + Intronic
1167899636 19:52609929-52609951 AGCAGTTACCACAGAGAAGAGGG - Intronic
1168411768 19:56144708-56144730 CCCCTTGACCACAAGGCAGAGGG - Intronic
1202700330 1_KI270712v1_random:159237-159259 ACCTGGGAGCACAGAGCAGAGGG + Intergenic
925759629 2:7171881-7171903 ACCAGTGACCTTAGAGGAGAGGG + Intergenic
928207343 2:29295502-29295524 ATCAGTGACCCCAGGACAAATGG - Intronic
929583672 2:43100740-43100762 ACCAGGGGCGACTGGGCAGAGGG - Intergenic
930573578 2:53117308-53117330 AACAGAGACCACGAGGCAGAGGG + Intergenic
930977405 2:57480195-57480217 GACAGTGGCCACAGGGGAGAAGG - Intergenic
931413103 2:62053715-62053737 ACCAGTTACCCCAGAGAAGAAGG + Intronic
932465846 2:71923586-71923608 TCCAGTAACCACGGGGCAAAGGG - Intergenic
933490994 2:82985737-82985759 ACCAGGCACCACAGAGCAGGGGG + Intergenic
933724493 2:85418857-85418879 ACCAGCGACTCCAGGGCAGAGGG - Intronic
934171263 2:89542713-89542735 ACCTGGGAGCACAGAGCAGAGGG + Intergenic
934281569 2:91617031-91617053 ACCTGGGAGCACAGAGCAGAGGG + Intergenic
934954607 2:98607279-98607301 ACCAGTGAGTAAGGGGCAGAAGG + Intronic
936093674 2:109516287-109516309 ATCAGTGACGCCAGGGGAGAGGG - Intergenic
936526549 2:113245459-113245481 ACCAGTGACCAGGGGGGTGAGGG - Intronic
937070173 2:119057210-119057232 AGGACTGACCAAAGGGCAGATGG + Intergenic
938313714 2:130312188-130312210 ACCAGTGACAAGATGGCAAACGG - Intergenic
938742283 2:134244363-134244385 ATCAATGAGCACAGGGAAGAAGG - Intronic
940966608 2:159844928-159844950 AACACTGAGCACAGGGGAGAGGG - Intronic
943520569 2:188944464-188944486 ACCAGGCACCGCAGAGCAGAGGG + Intergenic
946251775 2:218418473-218418495 ACCATTCACCCCAGGGCAGGTGG + Intergenic
1168913742 20:1469609-1469631 ACCAGTGAGGACACGGCAGAGGG - Intronic
1169793138 20:9432788-9432810 ACCAGTGACCACAGGGCAGAAGG + Intronic
1172621823 20:36322352-36322374 AACCCTGACCACAGTGCAGAAGG - Intronic
1172803088 20:37591891-37591913 GCTGCTGACCACAGGGCAGAGGG + Intergenic
1172869035 20:38123510-38123532 ACCAATGGCAACAGAGCAGAAGG + Intronic
1174357484 20:50008420-50008442 ACCAGTGGCAACAGGACAGCAGG + Intergenic
1174403176 20:50286920-50286942 AGCGGTGGCCACAGTGCAGATGG + Intergenic
1176199834 20:63855261-63855283 AGCTGTGGCCACAGGGCAGCGGG + Intergenic
1176199848 20:63855310-63855332 AGCTGTGGCCACAGGGCAGTGGG + Intergenic
1178126534 21:29521684-29521706 ATTAGTGAATACAGGGCAGATGG - Intronic
1179955250 21:44734853-44734875 GCCAGAGTCCACAGGGCACATGG - Intergenic
1180005927 21:45020516-45020538 AGCAGTGACCAGAAGGCACATGG + Intergenic
1180289566 22:10784400-10784422 ACCAGAGACCACAGGAGAAAGGG + Intergenic
1180714545 22:17862816-17862838 GCCAGTGAGCTCAGGGCTGAGGG - Intronic
1180954253 22:19734488-19734510 GCCAAGGACCCCAGGGCAGAGGG - Intergenic
1181054464 22:20253617-20253639 ACCAGTGACCACCAGGCATCCGG + Intronic
1181285204 22:21747151-21747173 AACAATGACCACAGTACAGAGGG - Intergenic
1182314259 22:29433420-29433442 TATAGTGACCACAGAGCAGATGG - Intergenic
1183179036 22:36246131-36246153 ACCAGTGACCATCAGTCAGAAGG + Intergenic
1183902662 22:41018248-41018270 ACCAGAGACCAGCGGGCAGGTGG - Intergenic
1184110211 22:42389755-42389777 ACCATTGCCCACTGGGCAGCAGG - Intronic
1184231982 22:43163267-43163289 ACCCCTGGCCACAGGGAAGAGGG + Intergenic
1185397186 22:50598925-50598947 ACCAGAAACGACATGGCAGAAGG - Intronic
950112088 3:10425741-10425763 ACCAGTGTGCAGATGGCAGAGGG - Intronic
950367328 3:12496860-12496882 ATCTGTGCCCACCGGGCAGAAGG - Intronic
950497108 3:13340419-13340441 AGCAGTGACCAGAGGGCCCAGGG + Intronic
951391204 3:22106356-22106378 AACAGTGACCAAAGGGCAGATGG - Intronic
951980972 3:28566513-28566535 AACAGTGTCGACAGAGCAGAGGG + Intergenic
953553391 3:43922998-43923020 ACCAGTGACCCAGGGACAGAAGG + Intergenic
953616210 3:44493030-44493052 CCCAGTTTCCACAGGCCAGATGG + Intergenic
957245658 3:77712612-77712634 ACCAGGGACCAGACTGCAGAGGG + Intergenic
961832887 3:129633282-129633304 TCCACTGAGCAAAGGGCAGAGGG + Intergenic
964566377 3:158058734-158058756 AACAGTAACCGCAGAGCAGAAGG - Intergenic
966441508 3:179950167-179950189 ACCAAGCACCACAGGGCAGTGGG - Intronic
967853332 3:194098302-194098324 CTCACTGACCACAGGGCAGTGGG + Intergenic
969028509 4:4193175-4193197 ACCTGGGAGCACAGAGCAGAGGG - Intronic
969386451 4:6852830-6852852 ACCTTTCACCACATGGCAGATGG + Intronic
969436793 4:7193279-7193301 ACCAGTGACCAGAGGCCAGTAGG - Intronic
970672305 4:18410918-18410940 AGCTGTGACCAGAGGGCAGTTGG + Intergenic
970675236 4:18441369-18441391 ACCAGTGATCAGAGGGAGGAGGG + Intergenic
971144426 4:23961641-23961663 CCCAATTACCACAGGGAAGAGGG - Intergenic
971144445 4:23961721-23961743 CCCAATTACCACAGGGAAGAGGG - Intergenic
975277696 4:72520844-72520866 AACAGTGGGCACAGGACAGAGGG - Intronic
975479246 4:74859612-74859634 ACCAGTGAGACCAGTGCAGAAGG + Intergenic
975965078 4:79963567-79963589 AGCAATGGCCAAAGGGCAGATGG - Intronic
979649016 4:123107766-123107788 ACCAGTGCCCAAAGTCCAGAGGG + Intronic
979793181 4:124812191-124812213 AACAAAGATCACAGGGCAGAGGG + Intergenic
981913174 4:150005987-150006009 ACCAGTGATCACAGAGGAGGGGG - Intergenic
990327290 5:54691065-54691087 ACCACTGAACCCAGGGCAGGAGG + Intergenic
992022062 5:72634588-72634610 AGCACTGACCACAGGACAGCAGG + Intergenic
992907330 5:81359155-81359177 ACCACTGCCAAGAGGGCAGAAGG - Intronic
994997331 5:107080245-107080267 ACCAATGACCTGAGGGTAGAGGG - Intergenic
996704999 5:126488809-126488831 ACTTGTGACCTCAGGCCAGATGG - Exonic
997425819 5:133801873-133801895 ACCAGAGAGCACAGGGCTGCTGG - Intergenic
997475219 5:134138750-134138772 ACAAGGGAACCCAGGGCAGAGGG - Intronic
997823905 5:137089476-137089498 GCCAGTGACCTGAGGGCAGTGGG + Intronic
1000258866 5:159566803-159566825 ACCAGTTCCCACAGGGCTGCAGG - Intergenic
1001681470 5:173560668-173560690 AATAGTGAACATAGGGCAGAAGG - Intergenic
1001786068 5:174414606-174414628 ACCAGGGCCCACAGACCAGATGG + Intergenic
1001929750 5:175664534-175664556 ACCTGAGACCCCAGGGCAGTGGG + Intronic
1002067845 5:176661137-176661159 CCCAGAGAAGACAGGGCAGAGGG - Intergenic
1002181026 5:177431257-177431279 AGCAGGGCCCACAGGACAGAGGG + Intronic
1002313382 5:178328138-178328160 ACCCTTGGCCAAAGGGCAGAGGG - Intronic
1002647807 5:180669817-180669839 TGCCCTGACCACAGGGCAGATGG - Intergenic
1004890739 6:20098034-20098056 ACCATTAACCACTGGGAAGAAGG + Intergenic
1006354072 6:33543448-33543470 TCCAGTGACCACATGGCTTACGG + Intergenic
1006378459 6:33684533-33684555 ACCACTGACCACTGGCCTGACGG - Intronic
1007703023 6:43775282-43775304 ACCAGAGACCACTGGGAAGCTGG - Intronic
1008600047 6:53084215-53084237 ACCAGTGACCACAGGGAATTAGG + Intronic
1008674583 6:53806131-53806153 TCCAGAGACCACAGAGGAGATGG - Intronic
1010164212 6:72896779-72896801 ACCAGTGACTACAGGGTGGCAGG - Intronic
1012313415 6:97756144-97756166 ACCAGTGAGAACAGAACAGAAGG - Intergenic
1015669665 6:135674035-135674057 ACCAGTAACCGCAGAGCTGATGG - Intergenic
1016281136 6:142420228-142420250 ACAAGTGACCACACTGCACATGG - Intronic
1018039138 6:159906199-159906221 CCCACAGACCACAGGCCAGATGG - Intergenic
1019267870 7:128894-128916 TCCAGTGAGCACAGAGCAGGTGG - Intergenic
1019699249 7:2465698-2465720 TCCACTGACCAGAGGGTAGATGG - Intergenic
1022849794 7:34248439-34248461 ATCAGTGGGGACAGGGCAGAGGG + Intergenic
1022927029 7:35066895-35066917 ACCAGTGCACACAGTGGAGAGGG - Intergenic
1023228266 7:37995648-37995670 TACAGTGACCACAAGACAGAAGG - Intronic
1024661537 7:51500068-51500090 ACCAGTGACCACAAGCCAGAGGG - Intergenic
1024751062 7:52466247-52466269 AACAGTAACCATAGGGCAGTGGG + Intergenic
1025999309 7:66548937-66548959 TCTAGTCCCCACAGGGCAGAAGG - Intergenic
1026010120 7:66629439-66629461 CCCAGTGACTACTGGGCGGAGGG - Intronic
1027438984 7:78197865-78197887 ACCTCTGACCCCAGGGCAGGTGG - Intronic
1028416391 7:90584952-90584974 ACCTAAGACCACAGTGCAGATGG - Intronic
1028582619 7:92423149-92423171 AGCAGTGGCCGCAGGGCTGAAGG + Intergenic
1032263116 7:130352189-130352211 CCCTCTGATCACAGGGCAGAGGG - Intronic
1032268350 7:130383584-130383606 AGCAGTGACCACAGAGGACATGG + Intronic
1033020146 7:137716450-137716472 ACCAGTGACCAGAAGACAGCCGG + Intronic
1035004932 7:155649696-155649718 ATCAGTGACCACAGGAGACAAGG - Intronic
1037771850 8:21805912-21805934 CCCAGTGGCTGCAGGGCAGAAGG + Intronic
1038445914 8:27604229-27604251 CCCAGTGACCCCAGGACACAAGG + Intronic
1040306038 8:46212328-46212350 ACCAGTGAAAACAGGGCCGCAGG + Intergenic
1040306764 8:46216013-46216035 ACCAGTGAAAACAGGGCAGCAGG + Intergenic
1040341064 8:46441343-46441365 ACAAGTGAACACCGGGCAGTAGG - Intergenic
1040834419 8:51717654-51717676 ACCAGAGACCACAGGGCAGCTGG + Intronic
1042004878 8:64169253-64169275 ACCAGTGCCCAGAGTCCAGAAGG - Intergenic
1042376761 8:68061133-68061155 GCCAGGGACCGCAGGGCAGAAGG + Intronic
1042414258 8:68501092-68501114 AGGAGAGACCACAGAGCAGAAGG - Intronic
1042727852 8:71897395-71897417 ACCAATGAAAACAGGGCAAAAGG + Intronic
1042865767 8:73355734-73355756 ACCAGTGCTCAGAGGGCAGCAGG + Intergenic
1043645586 8:82514159-82514181 ACCAGAGAACACAGGGCTTAAGG - Intergenic
1044017354 8:87060014-87060036 AGGAGTCACCCCAGGGCAGAGGG - Intronic
1046235557 8:111420096-111420118 ACCAGTGGCCACAGGTGAGCAGG + Intergenic
1047314517 8:123720195-123720217 GCCAGGGAGCAGAGGGCAGAGGG + Intronic
1048151517 8:131899860-131899882 ACCAGGGTCCACAAGGAAGATGG - Intergenic
1048944770 8:139434151-139434173 ACCAGTGACTACAGGGGTTATGG + Intergenic
1049373180 8:142277356-142277378 CCCAGTGCCCTCAGGGCACAGGG + Intronic
1049725129 8:144142282-144142304 GCCAGTGACCTCAGGGCCGAGGG + Intergenic
1052635843 9:31102977-31102999 ACCTTTGACTTCAGGGCAGAGGG + Intergenic
1055045014 9:71914840-71914862 ACCGGTGACCAATGGCCAGAGGG - Intronic
1056837608 9:89969887-89969909 TCCAGTAACCACAGGGCAGTAGG + Intergenic
1057228498 9:93304871-93304893 CCCAGTGACCAGTGTGCAGACGG - Intronic
1057571192 9:96205315-96205337 ACCAGTGATGCCAAGGCAGAGGG + Intergenic
1059932835 9:119278285-119278307 GCCAGTGCCCTCAGGGCAGTAGG - Intronic
1060047749 9:120354021-120354043 AGCTGAGAGCACAGGGCAGAGGG + Intergenic
1060984289 9:127810693-127810715 AACAGTGGCCACAGGGCAAGGGG - Intronic
1061118668 9:128629924-128629946 ACAGGAGACCTCAGGGCAGAGGG - Intronic
1061379354 9:130244772-130244794 CCCAGTGGCCACAGGGCAGCAGG + Intergenic
1062311442 9:135939811-135939833 ACCAGTGACCTGCGTGCAGAGGG + Intronic
1062338529 9:136083188-136083210 GCCAGTGGCCACAGGGCTCAGGG + Intronic
1185754566 X:2643137-2643159 AGCAGTGAGCACAGGGCTGGAGG + Intergenic
1188964125 X:36529794-36529816 ACTAGGCACCACAGAGCAGAGGG + Intergenic
1190106779 X:47566802-47566824 GCCGGGGACCACAGGGCAGAGGG + Intronic
1190152763 X:47961999-47962021 ACAAAAGATCACAGGGCAGAAGG + Intronic
1198397306 X:136233201-136233223 ACCAGTGAGCACAGGGATAATGG + Intronic
1199942004 X:152636847-152636869 ACCAGAGCCCATAGGGCAAATGG - Intergenic