ID: 1169797315

View in Genome Browser
Species Human (GRCh38)
Location 20:9477443-9477465
Sequence AGTATTGACCACGGTGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169797315_1169797319 -3 Left 1169797315 20:9477443-9477465 CCTTCTACACCGTGGTCAATACT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1169797319 20:9477463-9477485 ACTTTCTTCAGAAGCTAAAGGGG 0: 1
1: 0
2: 3
3: 25
4: 261
1169797315_1169797320 -2 Left 1169797315 20:9477443-9477465 CCTTCTACACCGTGGTCAATACT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1169797320 20:9477464-9477486 CTTTCTTCAGAAGCTAAAGGGGG 0: 1
1: 0
2: 2
3: 28
4: 270
1169797315_1169797318 -4 Left 1169797315 20:9477443-9477465 CCTTCTACACCGTGGTCAATACT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1169797318 20:9477462-9477484 TACTTTCTTCAGAAGCTAAAGGG 0: 1
1: 0
2: 1
3: 24
4: 285
1169797315_1169797317 -5 Left 1169797315 20:9477443-9477465 CCTTCTACACCGTGGTCAATACT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1169797317 20:9477461-9477483 ATACTTTCTTCAGAAGCTAAAGG 0: 1
1: 0
2: 2
3: 17
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169797315 Original CRISPR AGTATTGACCACGGTGTAGA AGG (reversed) Intronic
904974247 1:34443556-34443578 AGTATTGGCCATGATGAAGATGG - Intergenic
912924665 1:113903548-113903570 AGTATTGTACAAGGTGTAGAGGG + Intronic
1066497369 10:35955268-35955290 AATATTGCCCCAGGTGTAGAGGG - Intergenic
1070509420 10:77146963-77146985 AGTATTGACCATGGGGAAGGGGG + Intronic
1077832355 11:5887602-5887624 AATAGTGTCCACAGTGTAGATGG + Intronic
1081480247 11:43479702-43479724 AGAATTGATGACGTTGTAGAGGG + Intronic
1091419080 12:319407-319429 AATATTGAACACGGGGTATAAGG + Intronic
1091461703 12:647977-647999 AGTAATGACCACTGGGTAGTTGG + Intronic
1093931178 12:24956325-24956347 AGTATTAGCCAAGGAGTAGATGG - Intergenic
1098211646 12:68172458-68172480 AGTATTGAAGATGGTGAAGATGG + Intergenic
1151180030 17:72320624-72320646 AGTATTTGCCAGGGTTTAGAAGG - Intergenic
1160656741 19:276327-276349 AGAATTGACCACAGAGCAGAAGG + Intergenic
1165286524 19:34847130-34847152 AGTTTTGAGCAAGGTCTAGAAGG - Intergenic
942266245 2:174228852-174228874 AGTATGGAGAAGGGTGTAGAAGG - Intronic
942721489 2:178958111-178958133 AGTGTTTACCAGGGTTTAGAGGG + Intronic
1169797315 20:9477443-9477465 AGTATTGACCACGGTGTAGAAGG - Intronic
1174139844 20:48405200-48405222 AATATTGACCACCGGGGAGAGGG - Intergenic
949776173 3:7634968-7634990 AGTATTAACCACAGGGTACATGG + Intronic
950197623 3:11020265-11020287 AGTGTTGACCATGCTGTAGTTGG - Exonic
961202869 3:125058039-125058061 AAGATTGATCAAGGTGTAGATGG + Intergenic
962727739 3:138249720-138249742 AATATTGCCCACTGGGTAGAGGG + Intronic
963131219 3:141860022-141860044 AGCATTGACCCCAGTGTTGAAGG + Intergenic
978898506 4:113920372-113920394 ATTATTGTCCACAGTGTATAGGG - Intronic
981474248 4:145172265-145172287 GGTAGTGACCAGTGTGTAGAAGG + Intronic
986409948 5:7467422-7467444 AGCATTGACCGCCGTGGAGAAGG + Intronic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
995674989 5:114653506-114653528 AGTATTGCCCATGGTGTTGAGGG + Intergenic
1004325782 6:14672921-14672943 AGTATTTACCAGGGTCCAGAAGG - Intergenic
1007162068 6:39799818-39799840 ATTAATTACCAGGGTGTAGAAGG - Intronic
1011680314 6:89776990-89777012 AGTGTTGACCACTGGGTACATGG + Intronic
1016958429 6:149648849-149648871 AGTATAGACCTTGGTGTAGATGG + Intronic
1021885422 7:25132857-25132879 ATTATTGACCACTGAGTTGATGG + Intergenic
1022752344 7:33243056-33243078 TGTATGGACCACGTTGTAAATGG + Intronic
1028892995 7:96009676-96009698 AGTAGTGTTCACAGTGTAGAAGG - Intronic
1030371294 7:108702162-108702184 AGTGTTGACCACTATGTTGAAGG - Intergenic
1043432424 8:80207828-80207850 ACTATTGAGAATGGTGTAGAAGG + Intronic
1051986886 9:23100124-23100146 AGTATTGAGCATGTTGAAGAGGG + Intergenic
1058155061 9:101505751-101505773 TGTATTATCCACTGTGTAGAAGG - Intronic
1186036250 X:5426485-5426507 AGGATTGACCACGGAGTATGAGG + Intergenic
1190979109 X:55440194-55440216 ATTATTGACCACAGTTTAAAAGG + Intergenic
1195680394 X:107541672-107541694 TGTATTCACCACAGTGAAGAGGG - Intronic
1197743860 X:129917376-129917398 AATACTGACCACGATGTATATGG + Intronic