ID: 1169799886

View in Genome Browser
Species Human (GRCh38)
Location 20:9504017-9504039
Sequence AGGGGGGCGCCGTTAGTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169799886_1169799893 9 Left 1169799886 20:9504017-9504039 CCGCTGACTAACGGCGCCCCCCT No data
Right 1169799893 20:9504049-9504071 GCCATAACTACAGCTTTGATTGG 0: 28
1: 62
2: 80
3: 55
4: 122
1169799886_1169799895 17 Left 1169799886 20:9504017-9504039 CCGCTGACTAACGGCGCCCCCCT No data
Right 1169799895 20:9504057-9504079 TACAGCTTTGATTGGACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169799886 Original CRISPR AGGGGGGCGCCGTTAGTCAG CGG (reversed) Intergenic
No off target data available for this crispr