ID: 1169800326

View in Genome Browser
Species Human (GRCh38)
Location 20:9507045-9507067
Sequence TCTGGGGACTCGTGCAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169800326_1169800337 20 Left 1169800326 20:9507045-9507067 CCCCATCTGCACGAGTCCCCAGA No data
Right 1169800337 20:9507088-9507110 CCGCCGCCGCCTCCGCCGCCTGG No data
1169800326_1169800338 21 Left 1169800326 20:9507045-9507067 CCCCATCTGCACGAGTCCCCAGA No data
Right 1169800338 20:9507089-9507111 CGCCGCCGCCTCCGCCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169800326 Original CRISPR TCTGGGGACTCGTGCAGATG GGG (reversed) Intergenic
No off target data available for this crispr