ID: 1169802428

View in Genome Browser
Species Human (GRCh38)
Location 20:9523768-9523790
Sequence GTCTGAAGCCAGATGTAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169802421_1169802428 14 Left 1169802421 20:9523731-9523753 CCTGTGGAGGTGGATAGGGAGTC 0: 1
1: 1
2: 0
3: 14
4: 189
Right 1169802428 20:9523768-9523790 GTCTGAAGCCAGATGTAGTCCGG 0: 1
1: 0
2: 1
3: 12
4: 151
1169802418_1169802428 21 Left 1169802418 20:9523724-9523746 CCTAAGTCCTGTGGAGGTGGATA 0: 1
1: 0
2: 0
3: 16
4: 156
Right 1169802428 20:9523768-9523790 GTCTGAAGCCAGATGTAGTCCGG 0: 1
1: 0
2: 1
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169802428 Original CRISPR GTCTGAAGCCAGATGTAGTC CGG Intronic
900634681 1:3657197-3657219 ATCTGAAGCCAGGTGTGGGCAGG + Intronic
900790718 1:4678404-4678426 GGCTGAAACCAGATGTTGGCCGG + Intronic
901591128 1:10344069-10344091 GTCTGAAGGCAGATGAAGATGGG - Intronic
903016585 1:20365902-20365924 GCCAGAAGCCAGCTGTAGGCTGG - Intergenic
904251238 1:29225854-29225876 GTCTTAAGCCAGATGGACTTTGG - Intronic
904733569 1:32613117-32613139 GTTAGAAGCAAGATGGAGTCAGG - Intronic
905036290 1:34920055-34920077 TCCTGAAGCCAGATGTGGTGGGG - Intronic
907511001 1:54959352-54959374 GCATGAAGCCAGATTTAGTGTGG + Intergenic
911953917 1:104211766-104211788 GCCTCAAGCCAGAGGTAGTATGG - Intergenic
912078075 1:105902444-105902466 GCATGAAGCCAGATTTAGTGTGG - Intergenic
912759631 1:112355670-112355692 GCCTGAAGCCAGTGGTTGTCTGG - Intergenic
912813815 1:112813279-112813301 GTGGGAAGCCAGATTAAGTCCGG - Intergenic
916640187 1:166719689-166719711 GCATGAAGCCAGATTTAGTGTGG + Intergenic
921832271 1:219741426-219741448 GTCTGCAGCCAGTTGGAATCTGG - Intronic
922779336 1:228239559-228239581 CTCTGCAGCCAGATGTTCTCAGG - Intronic
1063800989 10:9577913-9577935 TCCTGAGGCCAGATTTAGTCTGG + Intergenic
1065349448 10:24782523-24782545 GGCTGAAGCCAGATATCGTGGGG + Intergenic
1065859674 10:29861493-29861515 GACTTAAGACAGATGTAGCCAGG - Intergenic
1067523529 10:47025472-47025494 GACTGAAGCCAGATGGGGTGGGG + Intergenic
1071120371 10:82269881-82269903 GTCTGGAGCCAGATTGAGTTAGG + Intronic
1072094540 10:92164261-92164283 GACTGAATCCAGGTTTAGTCTGG + Intronic
1074047460 10:109851755-109851777 GTCTGTAGCCTCAGGTAGTCTGG - Intergenic
1075417439 10:122275325-122275347 ATCTGAGTCTAGATGTAGTCCGG - Intronic
1077004119 11:343438-343460 GTTTGACGCTAGATCTAGTCTGG + Intergenic
1077207093 11:1349909-1349931 GGCTGAAGCCAGCTGTGCTCTGG - Intergenic
1079346901 11:19660584-19660606 GTCTGAAACCAGAGGTGGTTGGG - Intronic
1079686624 11:23366855-23366877 GTGTGAAGCAAGATGTAATCAGG + Intergenic
1082934017 11:58638067-58638089 GGCTGAGGCCAGAAGGAGTCTGG + Intergenic
1083705650 11:64512501-64512523 AACTGAAGCCAGAAGAAGTCTGG - Intergenic
1084641961 11:70431510-70431532 CTCTGCAGCCTGTTGTAGTCTGG + Intronic
1087646843 11:100818041-100818063 GTCTGAGGCCAGATCTAGCATGG + Intronic
1090913105 11:131138920-131138942 GTCTGAGGAAAGAGGTAGTCCGG - Intergenic
1091537196 12:1422254-1422276 GTTAGAAGCAAGATGGAGTCAGG + Intronic
1092448384 12:8579619-8579641 GTCTGAAGTCACATGTCATCAGG - Intergenic
1093947673 12:25128979-25129001 GGCAGAAGCCAGATAAAGTCAGG - Intronic
1095214782 12:39535189-39535211 GTCTGATTCCAAATGTGGTCAGG - Intergenic
1097660680 12:62427371-62427393 GTCTGAAACCAGGTGTTGGCAGG + Intergenic
1099473219 12:83075761-83075783 GTTTGAAGACAGATGTGGGCAGG - Intronic
1099997655 12:89796479-89796501 GTCTGACACAAGAAGTAGTCAGG - Intergenic
1101368616 12:104101986-104102008 TTCTTAAGCAAGCTGTAGTCAGG - Exonic
1104058169 12:125245960-125245982 CTCTGCAGCCAGATGCAGGCTGG + Intronic
1104789460 12:131472765-131472787 GTCTGCAGCCACCTGTGGTCTGG - Intergenic
1105656053 13:22439731-22439753 GGCTAAAGCCAGATATACTCAGG + Intergenic
1105938327 13:25122336-25122358 GTCTGTGGCCAGATGTACTGGGG - Intergenic
1107299554 13:38950564-38950586 GTTGGAAGCAAGATGGAGTCAGG + Intergenic
1108192815 13:47959861-47959883 GCATGAAGCCAGATCTAGTGTGG + Intronic
1111903707 13:94230930-94230952 GTCTGAAGCCAGAAAGGGTCAGG + Intronic
1112740449 13:102467182-102467204 GAGTGAAGCCAGAAGTAGGCTGG + Intergenic
1114072472 14:19125422-19125444 GTCTGCTGCCAGATGTATTGGGG + Intergenic
1114089788 14:19274553-19274575 GTCTGCTGCCAGATGTATTGGGG - Intergenic
1118315993 14:64726514-64726536 GGCTGCAGCCTGAAGTAGTCTGG + Intronic
1119177214 14:72577877-72577899 GTTTAAAGCGAGATGTATTCTGG - Intergenic
1119443141 14:74642316-74642338 GTCTGCAGCCAGAGGTAGCCTGG + Intergenic
1121078482 14:91088809-91088831 ACCTGAAGCCACATGTATTCTGG + Intronic
1123402958 15:20004611-20004633 GTTTGAAGGCAGATGAAGTGTGG + Intergenic
1123512298 15:21011265-21011287 GTTTGAAGGCAGATGAAGTGTGG + Intergenic
1127708263 15:61568284-61568306 GTCTGAAGCTACATTTATTCTGG + Intergenic
1130242602 15:82210480-82210502 GGCTGATGCCAGTTGTTGTCTGG - Intronic
1130457791 15:84130387-84130409 GGCTGATGCCAGTTGTTGTCTGG + Intergenic
1132278078 15:100587217-100587239 GCCTGAAGCCGGATTTAGTGTGG + Intronic
1133764926 16:8831230-8831252 GTTAGAAGCAAGATGGAGTCAGG + Intronic
1135998435 16:27270934-27270956 GTTAGAAGCAAGATGGAGTCAGG + Intronic
1140406855 16:74717005-74717027 GACTGAGGCCTGATGTTGTCTGG + Intronic
1141197269 16:81869416-81869438 GTCTGAACTAAGATGTACTCTGG - Intronic
1142570846 17:873078-873100 GTCTGAAGGCAGAGGAAGACGGG - Intronic
1143413905 17:6730932-6730954 GTCTGCTGCCAGATGTATTGCGG - Intergenic
1143691281 17:8568232-8568254 GTCTGAAGCAAGGTGTTGGCAGG - Intronic
1147469554 17:40647312-40647334 GTCTGAAGCCATATGCAGCCAGG + Intronic
1148041031 17:44707503-44707525 GTCTGATTCCAGATGTACTTTGG + Intergenic
1149734732 17:58982176-58982198 GTCTGAAGCTACATGTAAGCAGG - Exonic
1151081584 17:71335616-71335638 GTCTGAAGAAAGATGTAACCTGG - Intergenic
1167661697 19:50799271-50799293 GTGAGAAGGCAGATGTAGACAGG - Intronic
1168324947 19:55533743-55533765 CTCTGCAGCCAGATGCAGTGGGG + Intronic
927084484 2:19660913-19660935 GTATGAAGTCAGATCTAGTTTGG - Intergenic
929880648 2:45834308-45834330 AACTGAAGCAAGCTGTAGTCTGG + Intronic
938540852 2:132282392-132282414 GGCTGATGCCAGATGAAATCTGG + Intergenic
939667843 2:144972478-144972500 GTCTGAAGGAAGATGCAGGCGGG - Intergenic
941640154 2:167978407-167978429 GTTAGAAGCAAGATGGAGTCAGG + Intronic
942187099 2:173434271-173434293 GTCTAAACCCAGATTTAGTAAGG + Intergenic
942923809 2:181409534-181409556 GGCTGAAGACAGATGTGGTGGGG - Intergenic
943100780 2:183483657-183483679 GTCTGCTGCCAGATGTATTGGGG + Intergenic
945883548 2:215351236-215351258 GGTTGAAGCCAGATGTTGCCTGG - Intergenic
947484134 2:230531628-230531650 GCATGAAGCCAGATGTAGTGTGG + Intronic
947799141 2:232916834-232916856 GTCTGAGACCAGCTGTAGCCTGG - Intronic
1169628864 20:7602367-7602389 GTCTGTTGCCAGATGTATTGTGG - Intergenic
1169742867 20:8914347-8914369 GTTAGAAGCAAGATGGAGTCAGG - Intronic
1169802428 20:9523768-9523790 GTCTGAAGCCAGATGTAGTCCGG + Intronic
1173418585 20:42880486-42880508 GGCTGAAGCCAGAGGTAGTGGGG - Intronic
1174045757 20:47731519-47731541 TTTTGAAGCCAGCTGCAGTCGGG + Intronic
1175916331 20:62427695-62427717 GTCTGAAGCCACATAGAGTTGGG + Intergenic
1176420161 21:6507707-6507729 GTTAGAAGCAAGATGGAGTCAGG + Intergenic
1177311666 21:19403563-19403585 GACTGAAGCCAGACGTACTCAGG - Intergenic
1177702589 21:24657730-24657752 GCCAGAAGCAAGATGGAGTCAGG - Intergenic
1178422166 21:32451623-32451645 GTCTGAATCCAGGTGTTGGCAGG + Intronic
1179695653 21:43116027-43116049 GTTAGAAGCAAGATGGAGTCAGG + Intergenic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1180490917 22:15847794-15847816 GTCTGCTGCCAGATGTATTGGGG + Intergenic
1181294822 22:21828496-21828518 GTCTCAAGCCAGGGGTCGTCAGG + Intronic
951860851 3:27250774-27250796 GTCTGCTGCCAGATGTATTGAGG + Intronic
952678477 3:36062612-36062634 GTCTGAAGTCAGGTGCAGTTAGG - Intergenic
953363468 3:42321802-42321824 CTCTGAAGCCAGATGGAACCAGG + Intergenic
956154949 3:66285773-66285795 ATTTGAAGCCAGATGTATTCTGG + Intronic
957221276 3:77386246-77386268 CTCTGAAGTCAGATCTAGTCAGG - Intronic
957587988 3:82157691-82157713 GTCAGAAACAAGATGGAGTCGGG - Intergenic
959021295 3:101190219-101190241 GTATCAGGCCAGATTTAGTCTGG + Intergenic
961720501 3:128891720-128891742 TTCTGAAGCAATATGAAGTCAGG - Intronic
963019162 3:140855493-140855515 GTTAGAAGCAAGATGGAGTCAGG + Intergenic
967727022 3:192871627-192871649 GTCTGAAGCCAAGAGTGGTCAGG + Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
968992929 4:3926878-3926900 GTCTGAATCCAGGTGTTGGCAGG - Intergenic
969147699 4:5138747-5138769 GTAGGGAGCCAGACGTAGTCTGG + Intronic
969822545 4:9731483-9731505 GTCTGAATCCAGGTGTTGGCAGG + Intergenic
971913434 4:32826908-32826930 GTTAGAAGCCAGATGGAATCAGG - Intergenic
975344175 4:73275148-73275170 GTCAGAAGCCAGATGGACTATGG - Intergenic
979111578 4:116763627-116763649 GTCTGCTGCCAGATGTATTGGGG - Intergenic
979308195 4:119172834-119172856 GTTAGAAGCAAGATGGAGTCAGG + Intronic
979354889 4:119691607-119691629 GTCTGAACCCTGATGGAGGCAGG + Intergenic
980520722 4:133930034-133930056 GTCACAAGCCAGATATAGTCAGG - Intergenic
981680235 4:147389170-147389192 GTTTGTAGCAAGAAGTAGTCTGG - Intergenic
983266453 4:165513039-165513061 GAGTGAGGCCAGATGTAGCCTGG - Intergenic
985653379 5:1117334-1117356 GTCAGAACCAAGATGGAGTCAGG - Intergenic
986152989 5:5144872-5144894 GTCTGGAGCAAGCTGCAGTCAGG + Intronic
986543742 5:8873265-8873287 GTCAGACCCCAGATGTACTCTGG + Intergenic
989554464 5:42777149-42777171 GTCTGTAGCCAGATGAACTAAGG + Intronic
991230743 5:64330747-64330769 CTATGAAGCCAGCTGCAGTCGGG + Intronic
992341262 5:75825810-75825832 TTTTTAAACCAGATGTAGTCTGG + Intergenic
993799142 5:92309094-92309116 ATCTGTTGCCACATGTAGTCTGG + Intergenic
994217661 5:97157479-97157501 GTCTGCTGCCAGATGTATTAGGG + Intronic
994627980 5:102244675-102244697 GTCTGCTGCCAGATGTATTGAGG - Intronic
1002100430 5:176855019-176855041 GGCTGAAGCTAGTTGGAGTCAGG - Intronic
1003454956 6:6273508-6273530 GTCTGCAGGTAGATGGAGTCAGG - Intronic
1007235406 6:40387813-40387835 CTCTGAAGCAAGCTGTTGTCAGG + Intergenic
1009874489 6:69488801-69488823 CTCTGAAGCCAGATGGATTTGGG - Intergenic
1011825615 6:91302238-91302260 GTTAGAAGCAAGATGGAGTCAGG + Intergenic
1012713199 6:102634693-102634715 GCATGAAGCCAGATTTAGTGTGG + Intergenic
1020315571 7:6903227-6903249 GTCTGAATGCAGATGTTGGCAGG - Intergenic
1022839966 7:34154881-34154903 ATCTGCAGCCTGAGGTAGTCAGG + Exonic
1023169334 7:37375459-37375481 GTTCGAAGCAAGATGGAGTCAGG + Intronic
1023169433 7:37376268-37376290 GTTCGAAGCAAGATGGAGTCAGG - Intronic
1023695789 7:42844914-42844936 CTTTGCAGCCAGATGTAGTTTGG - Intergenic
1028557342 7:92138096-92138118 GTTAGAAGCAAGATGGAGTCTGG + Intronic
1030681000 7:112433735-112433757 GTTAGAAGCAAGATGGAGTCAGG + Intronic
1031162294 7:118182931-118182953 GTTTGAAATCAAATGTAGTCAGG - Intergenic
1034054993 7:148024947-148024969 GTTAGAAGCAAGATGGAGTCAGG - Intronic
1035435241 7:158854745-158854767 GTTAGAAGCAAGATGGAGTCAGG + Intergenic
1036805970 8:11834009-11834031 GTATGAAGCCACAAGTCGTCTGG + Intronic
1037553429 8:19997720-19997742 TTCTGGAGCCAAATGTAGTCTGG + Intergenic
1038169512 8:25116221-25116243 GTCTGATGCCAGGTGTAGGCAGG - Intergenic
1039320405 8:36424010-36424032 GTCTGCTGCCAGATGTAGGCAGG + Intergenic
1039797784 8:40930036-40930058 GTCTGAAGCCATGAGTAATCGGG + Intergenic
1045027458 8:98101391-98101413 GCCTAAAGCCAGCTGTACTCTGG + Intergenic
1052228393 9:26117530-26117552 GTATGAATCCAGATGTATCCAGG - Intergenic
1052970412 9:34373855-34373877 GTCAAAAGCCTGATGAAGTCTGG + Intronic
1057727607 9:97579142-97579164 GTCTGAACCCAGATGAGCTCTGG + Intronic
1058030939 9:100197079-100197101 GTCTGAAGCATGAGGCAGTCTGG - Intronic
1058905029 9:109475864-109475886 GTCTGAAGCCAGTGGTAGTCCGG + Intronic
1059225361 9:112667617-112667639 GTCTGAAGCCAGATGCTCTTTGG - Intronic
1062688185 9:137827208-137827230 GTCTGCAACCAGATGCAGCCAGG + Intronic
1188858492 X:35226928-35226950 TCATGAAGCCAGATGTAGTGTGG + Intergenic
1189268321 X:39733215-39733237 GTCTGAAGCCCCATGGAGGCTGG + Intergenic
1193363746 X:80606133-80606155 GCATGAAGCCAGATTTAGTGTGG + Intergenic
1194264821 X:91741456-91741478 GTCTGCTGCCAGATGTATTGGGG + Intergenic
1194451330 X:94047746-94047768 GTTAGAAGCAAGATGGAGTCAGG + Intergenic
1200581968 Y:4961902-4961924 GTCTGCTGCCAGATGTATTGGGG + Intergenic
1201705698 Y:16934208-16934230 GTTAGAAGCAAGATGGAGTCAGG + Intergenic