ID: 1169805565

View in Genome Browser
Species Human (GRCh38)
Location 20:9555963-9555985
Sequence GGCTGATCACAACTGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169805559_1169805565 17 Left 1169805559 20:9555923-9555945 CCAGCTGACTGCCAAGCAAATGA 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1169805565 20:9555963-9555985 GGCTGATCACAACTGCAAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 112
1169805558_1169805565 28 Left 1169805558 20:9555912-9555934 CCTGCTGAGAGCCAGCTGACTGC No data
Right 1169805565 20:9555963-9555985 GGCTGATCACAACTGCAAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 112
1169805557_1169805565 29 Left 1169805557 20:9555911-9555933 CCCTGCTGAGAGCCAGCTGACTG 0: 1
1: 0
2: 1
3: 25
4: 220
Right 1169805565 20:9555963-9555985 GGCTGATCACAACTGCAAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 112
1169805561_1169805565 6 Left 1169805561 20:9555934-9555956 CCAAGCAAATGAGTAAGGCTATC 0: 1
1: 0
2: 2
3: 15
4: 117
Right 1169805565 20:9555963-9555985 GGCTGATCACAACTGCAAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169805565 Original CRISPR GGCTGATCACAACTGCAAGA GGG Intronic
900399226 1:2466222-2466244 GGCTGGGCACAGCTGCGAGAAGG - Intronic
900658310 1:3771039-3771061 GGCTCCTCACAACTCTAAGAGGG + Intronic
901402552 1:9024842-9024864 GGCTGCTCCCAAAGGCAAGATGG + Intronic
904535368 1:31195919-31195941 GGCTGATATCAGCTGCAAGGTGG - Intronic
905215951 1:36407758-36407780 GGCTGATCACATCTGGAATGTGG + Intergenic
905396008 1:37667070-37667092 GGCTGAGCAGAGCTCCAAGATGG + Intergenic
905422475 1:37857655-37857677 GGCTGAGCACAACTGAACCATGG - Exonic
905925702 1:41748132-41748154 GACTGGTCACAAATGCAAGGTGG + Intronic
908250643 1:62263152-62263174 GGCCGATCACAACGGGAACACGG - Exonic
915056076 1:153132303-153132325 AGCTGATCACAAGTGCATGAGGG + Intergenic
924815807 1:247440965-247440987 GAATGATCACAACCTCAAGATGG - Intronic
1063292298 10:4761833-4761855 GGCTGCTAACAACAGCATGAGGG - Intergenic
1064359709 10:14653041-14653063 GGCTGAACACAAAACCAAGAAGG + Intronic
1067600402 10:47592520-47592542 GCCTGGTCACGCCTGCAAGAGGG + Intergenic
1068237845 10:54262408-54262430 GCCTGACCACTCCTGCAAGAGGG + Intronic
1068612655 10:59077315-59077337 GTCTGATCAAAAATGGAAGACGG - Intergenic
1069069269 10:63976979-63977001 TGCTGATCATAAATGCAAGTGGG - Intergenic
1071167661 10:82825345-82825367 GGATGATCAGAACTGCACAAAGG - Intronic
1071651937 10:87400392-87400414 GCCTGGTCACGCCTGCAAGAGGG + Intergenic
1074790726 10:116884617-116884639 GACAGATCACAGATGCAAGAAGG + Exonic
1076799593 10:132814500-132814522 TGCTGCCCACAACTGCAGGACGG + Intronic
1077928938 11:6710305-6710327 GGGTGATGACAACTGCAGGCTGG + Intergenic
1078155305 11:8794855-8794877 GGCTGAGAACACCTGGAAGAGGG - Intronic
1081777898 11:45688874-45688896 GACTGATCAGACCTGCAGGAGGG - Intergenic
1084715339 11:70870029-70870051 CACTGATCACATCTGCAAGGAGG - Intronic
1089174217 11:116536624-116536646 GGATCAGCACATCTGCAAGAAGG + Intergenic
1090455247 11:126843463-126843485 GGCAGATCACAATTGAAAGCAGG - Intronic
1091657208 12:2354364-2354386 GGCTTATCACCACTCCAAGCAGG - Intronic
1092173577 12:6388354-6388376 GGGTGATCACAGCCCCAAGAAGG - Intronic
1092894281 12:12998047-12998069 GGCTGGACACAAATGCAATAAGG - Intronic
1098206818 12:68119489-68119511 AGCTGTCCCCAACTGCAAGATGG + Intergenic
1100122779 12:91388223-91388245 GGGAGATGACAACTGGAAGAAGG + Intergenic
1101238310 12:102812583-102812605 GGCTGAACCCAACTGGAAGTCGG - Intergenic
1104404182 12:128503958-128503980 GTCTGTTCACAACTGCAAAAGGG - Intronic
1105038921 12:132946732-132946754 GGCAGCTCACAGCTGGAAGAGGG + Intronic
1105405993 13:20133171-20133193 GGCTATTCACAACAGCAAAAAGG - Intergenic
1106137375 13:26983782-26983804 GGCTGATCCCATATGCATGAGGG - Intergenic
1108430098 13:50344754-50344776 GCCTGAACACATCTCCAAGAAGG - Intronic
1108617501 13:52148743-52148765 AGATGATCACAGCTGGAAGAAGG + Intronic
1117149033 14:52866560-52866582 GGCTGCTTAGCACTGCAAGATGG + Intronic
1119949585 14:78730576-78730598 GGCTGCACAAAACTGCAAGGTGG + Intronic
1123031818 14:105455510-105455532 CCTTGATCACAACTGCAAGCAGG - Intronic
1126426291 15:48530234-48530256 GCCTGATCACAACTTGAAAATGG + Intronic
1126426296 15:48530288-48530310 GCCTGATCACAACTTGAAAATGG + Intronic
1129924895 15:79355278-79355300 GTATGATCACAGCTGCCAGAAGG + Intronic
1131158801 15:90091165-90091187 GGCTCGTCACAACTGCAGGCTGG + Intronic
1131820111 15:96263889-96263911 GTCTCAACCCAACTGCAAGAAGG + Intergenic
1139149534 16:64364344-64364366 TGCTGATCACAAGTGCATGCTGG + Intergenic
1141456033 16:84143163-84143185 GCCTACTCACAACTGCCAGAAGG + Intronic
1142882005 17:2889253-2889275 GGCTCATCACCACTGCAATTTGG - Intronic
1144893432 17:18509615-18509637 GGCTCACCACAAATGCAAAATGG + Intergenic
1145138794 17:20434659-20434681 GGCTCACCACAAATGCAAAATGG - Intergenic
1147052724 17:37808401-37808423 GGCTGAACAGAACTGAGAGAGGG - Intergenic
1149103550 17:52935032-52935054 GGCTCATCACTACTGCTAGGAGG - Intergenic
1151244016 17:72780344-72780366 GGCTGATCATAACTACATGGAGG + Intronic
1151388908 17:73772436-73772458 TGCTGATCACAGCTGGGAGAAGG - Intergenic
1152737896 17:82006428-82006450 GAATGATCACATCTGCATGAGGG + Intronic
1153339613 18:3960799-3960821 AGCTTCCCACAACTGCAAGAGGG - Intronic
1154324272 18:13378898-13378920 GTCAGATCAGAACTGGAAGAGGG + Intronic
1162122608 19:8480940-8480962 GTCTGATCACAGCGGCAGGAGGG - Intronic
926891496 2:17643093-17643115 GGCTTATCACATCTGCTTGAGGG + Intronic
928251238 2:29682850-29682872 TGCTGATCACAACAGAAAGAAGG + Intronic
932865866 2:75341170-75341192 GGCTGATAAGAACTTGAAGAGGG - Intergenic
938991625 2:136635578-136635600 TGGTTATCACAACTGCAGGAAGG + Intergenic
942475213 2:176312025-176312047 ATCTGCACACAACTGCAAGAGGG - Intronic
945043534 2:205762631-205762653 GGCTGAATACTTCTGCAAGATGG - Intronic
946043119 2:216799505-216799527 TCCTGAGCACAAGTGCAAGAGGG - Intergenic
948715846 2:239862708-239862730 GCCTCCTCACAACTGAAAGAGGG + Intergenic
1169805565 20:9555963-9555985 GGCTGATCACAACTGCAAGAGGG + Intronic
1170669750 20:18420845-18420867 GGCTGACCTCAACTGCATGAGGG - Intronic
1171900319 20:30850399-30850421 GTCTTATCTCAACTGCAAAAAGG + Intergenic
1174035645 20:47666675-47666697 AGGTGATCACACCGGCAAGACGG + Intronic
1179183583 21:39065416-39065438 CACTGCTCACAACTGGAAGATGG + Intergenic
1180333685 22:11556390-11556412 GTCTTATCTCAACTGCAAAAAGG + Intergenic
1180598245 22:16993952-16993974 GGGTGTTCACAAATGCAAGAAGG - Intronic
1182512911 22:30831840-30831862 TGCTGATCACAGCAGCAGGATGG - Intronic
954436077 3:50497051-50497073 GGCTGATCAGAACTCAAAGGGGG + Intronic
954489692 3:50891688-50891710 GGCTGATCAGAGCTGAAAGTGGG + Intronic
955922870 3:63976070-63976092 TGCTGAGCACAACTGCAATGTGG - Intronic
956508742 3:69972259-69972281 GGCTGATCAGAACTACTACAGGG - Intergenic
964336494 3:155660180-155660202 GGCTGAACACAATTGAAAGTCGG + Intronic
965984189 3:174731864-174731886 CGCTGATCTCAACTGCTAGTTGG + Intronic
966175955 3:177138139-177138161 TACTAATCACAACTACAAGAAGG + Intronic
967062105 3:185881652-185881674 GGCTGAGCAGAACAGGAAGAGGG + Intergenic
968058054 3:195708171-195708193 GACGGATCACCGCTGCAAGAGGG + Intergenic
970505904 4:16730222-16730244 GGCTGAACAGAACTACAAAAGGG - Intronic
980325576 4:131340726-131340748 AACTGATCACAATTGCCAGAGGG - Intergenic
984567001 4:181343099-181343121 TGGTGCTCACAACTGCACGAAGG + Intergenic
985679291 5:1247485-1247507 GGGGCATCACAACTGCAGGACGG - Intergenic
988572853 5:32389272-32389294 GGATGGTCAAAACTGGAAGAAGG + Intronic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
993251605 5:85531834-85531856 GGCTGGTGAAAAATGCAAGATGG - Intergenic
996411449 5:123163650-123163672 GACAGATCACATCCGCAAGAAGG + Intronic
996576342 5:124980477-124980499 GACTAATAAAAACTGCAAGAGGG - Intergenic
998241336 5:140447897-140447919 GGCTACACATAACTGCAAGAGGG + Intronic
1000602713 5:163294353-163294375 GGCTGAACACAAGTGAATGAAGG + Intergenic
1007352668 6:41285235-41285257 GTCTGTGCACAATTGCAAGAAGG + Intronic
1008995202 6:57651114-57651136 TGGTGATCACAACTGGAGGAGGG + Intergenic
1009183740 6:60549874-60549896 TGGTGATCACAACTGGAGGAGGG + Intergenic
1009422585 6:63480190-63480212 GGCTGACCAGAGCTGCAACAAGG + Intergenic
1010815875 6:80357424-80357446 GGCTAAACCCAATTGCAAGATGG + Intergenic
1011328511 6:86177409-86177431 GAATGACCACAACTGCAATAAGG + Intergenic
1011761357 6:90569381-90569403 GGATGATTAAAACTGAAAGAGGG - Intronic
1016473484 6:144400390-144400412 GGCTGATCAGAATAGCATGACGG + Intronic
1017647170 6:156550278-156550300 GGTTTATCACCACAGCAAGAAGG - Intergenic
1018618652 6:165710009-165710031 GGCTGAGCAAAACTGTGAGATGG - Intronic
1018895718 6:168015536-168015558 GCCTGAACACAACTGCATGGGGG - Intronic
1019153456 6:170023835-170023857 ATCTGATCCCATCTGCAAGATGG - Intergenic
1024985015 7:55187171-55187193 GCCTCATCACAAAGGCAAGATGG + Intronic
1027025614 7:74850025-74850047 GATTGATCCCAACTGCAAGCCGG + Intronic
1027062150 7:75094094-75094116 GATTGATCCCAACTGCAAGCCGG - Intronic
1027366247 7:77461463-77461485 GGCTGACCTCAACTGCATGAAGG + Intergenic
1042878368 8:73460995-73461017 GGGTGAACTCAACTGAAAGAAGG - Intronic
1052111120 9:24583293-24583315 GGCTCATCAAACATGCAAGAAGG - Intergenic
1052712302 9:32071536-32071558 AGTTGAACACAACTGCAAGCTGG + Intergenic
1055459314 9:76502963-76502985 GGCTGACCTCAACTGCATGAAGG + Exonic
1058179627 9:101780800-101780822 TGATGGTCACAACTGCAAAAAGG + Intergenic
1062074516 9:134577914-134577936 GGCAGAACAGAAATGCAAGAAGG + Intergenic
1189914417 X:45842869-45842891 AGCTGATGACAAGTGGAAGATGG + Intergenic
1198035635 X:132798724-132798746 GGCTGATCTCAAGTTCAAGGTGG + Intronic