ID: 1169806989

View in Genome Browser
Species Human (GRCh38)
Location 20:9569590-9569612
Sequence TGCCACTGAGAAGTGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169806980_1169806989 27 Left 1169806980 20:9569540-9569562 CCAAGGGAGGAAAGTATTTCAAG 0: 2
1: 2
2: 15
3: 112
4: 483
Right 1169806989 20:9569590-9569612 TGCCACTGAGAAGTGGGATGGGG 0: 1
1: 0
2: 3
3: 28
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169806989 Original CRISPR TGCCACTGAGAAGTGGGATG GGG Intronic
901685765 1:10942539-10942561 TGCAACTGGGAAGTGGGGAGAGG + Intergenic
902720690 1:18302214-18302236 TGCCACTGGGGAGAGGGTTGGGG - Intronic
903186845 1:21633894-21633916 TCCCAGTGAGAAGAGGGCTGTGG + Intronic
903340944 1:22653921-22653943 TGCAGCTGGGGAGTGGGATGTGG + Intronic
903581233 1:24372517-24372539 TGCCAGTGAGCCCTGGGATGTGG - Intronic
903704195 1:25273002-25273024 TGCCACTGAGGAGAGAGAAGGGG - Intronic
904581522 1:31547626-31547648 TGCTGCTGAGACGTGGGCTGAGG + Intergenic
905647653 1:39635537-39635559 TGCCTCTGAGATATGGGAAGAGG - Intronic
906120320 1:43385724-43385746 TGACACAGAGATGTGAGATGCGG + Intronic
910072342 1:83232277-83232299 TGGCAATGAGAAGTAGGATATGG + Intergenic
910241896 1:85095674-85095696 TTCCACTGAGGGGTGGGTTGGGG + Intronic
910994754 1:93092493-93092515 TGCCTCTAAGGAGTGGGAAGGGG - Intronic
911310703 1:96289067-96289089 TGGCAGTCAGAAGGGGGATGGGG + Intergenic
913149363 1:116025384-116025406 GTCCAATGAGTAGTGGGATGAGG - Intronic
914947142 1:152077960-152077982 TGCCACTGAGCAGTGGGTTCTGG + Intergenic
915530591 1:156500374-156500396 TCCCCCTGAGGGGTGGGATGGGG - Intronic
916122129 1:161537947-161537969 TGCCACTGAGAAGTGTGCCAGGG - Intergenic
916132017 1:161619372-161619394 TGCCACTGAGAAGTGTGCCAGGG - Intronic
917872359 1:179253418-179253440 TGTCACTGACATGTGGGATCTGG + Intergenic
917957084 1:180110358-180110380 GGCCAGTGATAAGTGGTATGGGG + Intronic
918158803 1:181877599-181877621 TCCCACTGAAAAGTGGGCTAAGG + Intergenic
920075227 1:203331248-203331270 TGACACTGATAAGTGGGACTTGG - Intergenic
920363813 1:205437547-205437569 TGGCTCTGAGAAGTGAGAGGGGG - Intronic
920528140 1:206683921-206683943 TGCCAGTCAGAGGTGGGAGGAGG + Intronic
921721794 1:218480613-218480635 TTCCACTGAGAAGAGTGCTGCGG + Intergenic
923429818 1:233909261-233909283 TGCCACTGAGAAGAGGAACTGGG - Intronic
924532388 1:244904410-244904432 TCTGACTGAGAAGTGGGGTGGGG - Intergenic
1063769218 10:9178109-9178131 GGACACTGAGATCTGGGATGGGG - Intergenic
1064300871 10:14121569-14121591 TGCCACTGAGAGGTGTGAAAGGG + Intronic
1064932240 10:20640713-20640735 GCCCACTGAGAAGAGGGCTGTGG + Intergenic
1065072334 10:22038823-22038845 TGCCACTGAGAGCTGGGGAGTGG - Intergenic
1065173709 10:23056804-23056826 TGTCTCTGAGATGTGGGATCTGG + Intergenic
1066522576 10:36238701-36238723 TGCCACTGAGATGTGTGCTGGGG - Intergenic
1066532721 10:36358047-36358069 TGCCACAGAGAGGTAGGATAGGG - Intergenic
1067842978 10:49696739-49696761 TTCCTCTGAGCAGTGGGATTGGG + Intronic
1069200526 10:65609521-65609543 TTCCACGTAGAAGTGGGATTAGG - Intergenic
1071121766 10:82287056-82287078 TGTCACTGAGAAGAGGAAGGAGG + Intronic
1072113497 10:92346389-92346411 AGCAAGTTAGAAGTGGGATGAGG - Intronic
1072519984 10:96222767-96222789 TGCATCTGAGAAGAGGGAAGTGG + Intronic
1073509692 10:104035237-104035259 GGGCACTGTGGAGTGGGATGGGG - Intronic
1073510805 10:104041266-104041288 TACCACTGGGAGGTGGGAGGGGG - Intronic
1075153080 10:119952704-119952726 TATCACTGAGGAGTTGGATGGGG + Intergenic
1077034378 11:487744-487766 GGTCCCTCAGAAGTGGGATGGGG - Intronic
1077101600 11:824905-824927 TACCACTGCGCAGTGAGATGAGG + Exonic
1077387337 11:2276402-2276424 TGCCACTGAGCATTGAGACGTGG - Intergenic
1078187463 11:9064587-9064609 TGCCTCTGGCAAATGGGATGAGG + Intronic
1079141357 11:17812133-17812155 TGCCATGGAGAAGTGGGTTGGGG - Intronic
1079168424 11:18068544-18068566 TGCCAGTGGGAACTGTGATGAGG - Intergenic
1080049352 11:27843212-27843234 TGCCTCTGAAAAGTGGGAATGGG - Intergenic
1080822985 11:35824692-35824714 TGCAACTCAGAGGTGGGTTGTGG - Intergenic
1081509781 11:43758439-43758461 TGACCCTGAGATTTGGGATGGGG - Intronic
1083335924 11:61921669-61921691 TGACACTGAGAAGGGTGACGAGG - Intergenic
1084670491 11:70603895-70603917 TGGCACCCAGAAGTGGGGTGAGG + Intronic
1085708178 11:78805417-78805439 TGCCACTGCTCTGTGGGATGGGG - Exonic
1085764645 11:79272128-79272150 TCCCTCTGGGAGGTGGGATGTGG - Intronic
1086029478 11:82336604-82336626 GGCAACTGAGAAGTGGCAAGTGG - Intergenic
1086879572 11:92137679-92137701 GGACTCTGAGAATTGGGATGGGG - Intergenic
1087268109 11:96083066-96083088 GGCCTCTGAGAAGTGGCACGTGG + Intronic
1088114583 11:106300354-106300376 TGACACTGAGAAGTGGGAATAGG - Intergenic
1088624796 11:111722169-111722191 TGCCACTGAGGGGTGGGAACGGG + Intronic
1090339837 11:126007593-126007615 TTCCACTGGGAAGTGGGATCTGG + Intronic
1090668448 11:128930477-128930499 TGCCACTGAGAAGGAGGCCGGGG + Intergenic
1090745218 11:129699845-129699867 TGCCACTCAGAAGTGGCAGAAGG - Intergenic
1091446941 12:549199-549221 AGCCACAGAGAAGGGGGGTGGGG - Intronic
1091635140 12:2191153-2191175 TGCCAGGGAGATGTGGGGTGTGG + Intronic
1092444338 12:8539876-8539898 AGGCACTGAGAAATAGGATGGGG + Exonic
1092729259 12:11512948-11512970 TGCCACTCAGAAGCAGGAAGTGG + Intergenic
1093098303 12:14997083-14997105 TGAGACTCAGAAATGGGATGAGG + Intergenic
1093665027 12:21802205-21802227 TGCCTCAGAGAAGGGTGATGAGG + Intronic
1094048453 12:26194186-26194208 TGCTACTGAGTAGAGGTATGCGG + Intronic
1096530109 12:52236974-52236996 TGCCCCTGAGGGGTGGGATTAGG + Intronic
1097198952 12:57261839-57261861 AGCCAGTGGGAAGTGGGAGGGGG + Intronic
1097680835 12:62647533-62647555 TGATACAGAAAAGTGGGATGGGG + Exonic
1099094027 12:78350734-78350756 TCCCATTGAGGAGAGGGATGGGG + Intergenic
1100294937 12:93252207-93252229 GGCCACTTGGAAGTGGGATATGG - Intergenic
1100399648 12:94217672-94217694 TACCCCTTAGAAGTGGCATGGGG - Intronic
1101331061 12:103758258-103758280 TGCCACAGAACAGTGGGCTGGGG + Exonic
1102053220 12:109878427-109878449 TGCAACTGAGTTGGGGGATGGGG - Intronic
1102112397 12:110374242-110374264 TGCCACTCAGGAGGAGGATGTGG - Exonic
1103919167 12:124390550-124390572 TGCCGATGAGCAGTGGGACGAGG - Intronic
1108579987 13:51819787-51819809 TGCCACTAGGAAGGGTGATGTGG + Intergenic
1109233047 13:59782444-59782466 TGCCTCTGGGAAGTGGGAGGAGG + Intronic
1110456382 13:75694675-75694697 TTCAACAGAGAAGTGAGATGTGG + Intronic
1110630742 13:77703849-77703871 TGCCACTGAAAAGTAATATGTGG - Intronic
1111059620 13:82999005-82999027 TGCCACCCAGAAGAGTGATGTGG - Intergenic
1111656941 13:91165775-91165797 TACCACTGAAAAGTGTGATTCGG + Intergenic
1113280294 13:108781182-108781204 TACCACTGATAAGTGGAGTGCGG + Intronic
1113293455 13:108931512-108931534 TGACATTCAGAAGTGGGGTGCGG - Intronic
1113678293 13:112223239-112223261 TGGCACGGGGAAGTGGCATGGGG - Intergenic
1114249234 14:20943832-20943854 TGGGCCAGAGAAGTGGGATGTGG + Intergenic
1114612042 14:24049182-24049204 GGCAACTGAGAGGAGGGATGGGG - Intergenic
1118468703 14:66055109-66055131 GGCCACTGAGATCTGGGGTGAGG - Intergenic
1119425823 14:74534111-74534133 TGCTACTGAGAAATGGGAAGGGG + Intronic
1119709193 14:76809179-76809201 GGCCACAGAGCAGTGGGAAGAGG - Exonic
1121602696 14:95217900-95217922 TCCCTCAGAGAACTGGGATGAGG + Intronic
1122042845 14:99001512-99001534 GGCCAATGAGATGTGGCATGAGG + Intergenic
1122650709 14:103225029-103225051 AGCCACTGAGATGTGGGGAGTGG - Intergenic
1122715286 14:103693256-103693278 AGCCACCGAGAAGGGGGCTGGGG - Intergenic
1122918849 14:104871357-104871379 TGGCACTGAGCAGAGGGAAGGGG - Intronic
1124057876 15:26259380-26259402 TGTGACTGGGAAGGGGGATGGGG - Intergenic
1125004896 15:34806607-34806629 TGCCACAGAGACTGGGGATGGGG - Intergenic
1125728817 15:41881780-41881802 TGCCACTGAGGACTGGGGTGAGG + Intronic
1126130955 15:45340745-45340767 TGCAAATGTGAAGTGGGATGTGG - Intergenic
1128142529 15:65312168-65312190 AGCCACTGGGAAATGGGGTGAGG - Intergenic
1129170623 15:73805347-73805369 TGCCGCAGAGAAGTGGGGAGGGG + Intergenic
1129652915 15:77504322-77504344 AGGTGCTGAGAAGTGGGATGAGG + Intergenic
1131068798 15:89451156-89451178 TGCCCTTGAGGGGTGGGATGCGG + Intergenic
1131669266 15:94601846-94601868 TGCAAGTGAGAATGGGGATGTGG - Intergenic
1132035488 15:98480406-98480428 TGCCACTGAGATGAGAAATGTGG + Intronic
1134058253 16:11183342-11183364 TGCCACAGAGCAGTAGGACGTGG - Intergenic
1134336004 16:13300251-13300273 TCCCACTCAGAAATGGAATGTGG - Intergenic
1134853073 16:17497863-17497885 TGCAAATAAGATGTGGGATGTGG + Intergenic
1135030700 16:19036035-19036057 TGGGACTGGGAAGTGGGGTGGGG + Intronic
1137771539 16:51019770-51019792 TGCCACTCAGATGTGGGAGGAGG + Intergenic
1137898395 16:52238280-52238302 GGCCATGGAGCAGTGGGATGGGG + Intergenic
1138329730 16:56204046-56204068 AGGCAATGAGAAGTTGGATGGGG + Intronic
1138513002 16:57519354-57519376 TTCCAGTGGGGAGTGGGATGAGG - Intronic
1140632367 16:76869286-76869308 TGTGAGTGAGAAGTGGGATTTGG - Intergenic
1140878337 16:79174195-79174217 TGCCACTGAAAACTGGGCTGAGG - Intronic
1141402564 16:83763185-83763207 TGCCAGTGAAAAATGTGATGTGG + Intronic
1141607541 16:85163331-85163353 TGCAACCGAGAAGTGCCATGAGG - Intergenic
1142448903 16:90162136-90162158 TGCCAGTGGGAAATGGGATGCGG + Intergenic
1145121568 17:20264849-20264871 TCCCACTTATAAGTGAGATGTGG + Intronic
1145756241 17:27392411-27392433 TGCCTCTGGGGAGTGGGATTGGG - Intergenic
1146287734 17:31585533-31585555 TGCAACCCAGAAGTGGGGTGGGG + Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1146437057 17:32859967-32859989 TGCCACTGGTAAGAGGAATGTGG - Intronic
1146638453 17:34523017-34523039 TGTCACTGAAATGTGGGAGGTGG + Intergenic
1148331650 17:46817324-46817346 TGTGAGTGAGAAGTGGGCTGTGG - Intronic
1148544082 17:48503643-48503665 TGCCCCTGGTAACTGGGATGGGG + Intergenic
1149331648 17:55588814-55588836 TGCCACTTGGAAAAGGGATGTGG - Intergenic
1149891469 17:60393127-60393149 TGCCACGGACCAGTGGGAGGGGG - Intronic
1150307685 17:64100242-64100264 TGCCACTGAGGAGGGGGAATGGG + Intronic
1150722514 17:67625643-67625665 TGCCACGGAGCAGTGGGAAGTGG - Intronic
1150995909 17:70317256-70317278 AGACACTGAGAAGTGGAACGGGG + Intergenic
1152274654 17:79349239-79349261 TTCCACTGAGCTGTGGGCTGCGG + Intronic
1152637419 17:81435805-81435827 TGCCACTGAGGAGTGGGGGAAGG - Intronic
1152656072 17:81519714-81519736 TGACGCGGAAAAGTGGGATGGGG + Intronic
1153228877 18:2918660-2918682 TGCCACTGAGAACTGTGTTTAGG + Exonic
1156268446 18:35509189-35509211 TGGCACTGAGAAGAGGGGAGAGG - Intergenic
1156396971 18:36707431-36707453 TTCCACGGAGGAGTGGGATTTGG + Intronic
1156717440 18:40028064-40028086 AGTCATTGAGAAGTTGGATGGGG + Intergenic
1157158279 18:45288676-45288698 TGACCCTCAGAATTGGGATGAGG - Intronic
1157473441 18:48007135-48007157 GCCCACTGGGAAGTGGGCTGTGG + Intergenic
1157746695 18:50142136-50142158 TGCCAGTGAAATGTTGGATGGGG - Intronic
1159560418 18:69986909-69986931 TGGTACTGAGAAGTAGGGTGTGG - Intergenic
1160989213 19:1853777-1853799 TGCTTCTGAGACCTGGGATGGGG - Exonic
1161083922 19:2325239-2325261 TGACACTGAGAAGGGTGAAGGGG + Intronic
1162044401 19:7988950-7988972 TTCCACTGCGAAGCGGGAGGTGG + Intronic
1162156973 19:8684841-8684863 TGCCAAGGAGGAGAGGGATGAGG - Intergenic
1162821405 19:13225598-13225620 TGGCACAGAGAAGGGGGGTGAGG + Intronic
1164895480 19:31873625-31873647 TGCCACTGGAAGGTGGGAAGCGG - Intergenic
1164932459 19:32186204-32186226 TCCCACGGAGAAGAGGGGTGGGG + Intergenic
1166042785 19:40213574-40213596 TGGCACTGAGAGGTAGGACGGGG - Exonic
1166289651 19:41854324-41854346 TGGCACTGGGAAGTGGGAAAGGG - Intergenic
1166857618 19:45791122-45791144 TGCCACTGAGGAGAAGGAAGAGG + Intronic
1168677136 19:58286703-58286725 TGCAACTGAGAATTTGGATTTGG - Exonic
925589119 2:5492881-5492903 TGCCACAGGGACGTGTGATGGGG - Intergenic
926223476 2:10951471-10951493 TTCCTCTGAGATGTGGGTTGTGG + Intergenic
926303651 2:11621599-11621621 AGCCACTGGGAGGAGGGATGAGG - Intronic
927344029 2:22015783-22015805 TGCCACTGAAAAGTTGGAAGAGG + Intergenic
928228687 2:29477245-29477267 TGCCTCTGGGTAGTGGGATGAGG - Intronic
928780719 2:34815427-34815449 TTCCACTAAGAAGTGGAATTGGG + Intergenic
928962602 2:36943245-36943267 TACCTCTGGGGAGTGGGATGAGG - Intronic
929764929 2:44836540-44836562 TGCCACTGTGCAGGGGGCTGCGG - Intergenic
932386907 2:71343388-71343410 TGCCACTGTGGGGTGGGGTGAGG - Intronic
932736159 2:74256198-74256220 CTCCACTGAGATGTGGGTTGAGG + Intronic
934903214 2:98177223-98177245 TGAGATTGACAAGTGGGATGGGG + Intronic
934979715 2:98829774-98829796 AGCCGCTGAGGAGTGGGCTGGGG + Intronic
935291147 2:101611995-101612017 TGGGACTGGGAAGTGGGGTGAGG + Intergenic
935431703 2:102983076-102983098 TCCCACTGAGAAGTGAGTTTAGG + Intergenic
937014001 2:118587050-118587072 AGCCACTGTTAAGTGGGAGGTGG + Intergenic
937246307 2:120496299-120496321 TGCCTCTGTGAAGTGGGATGAGG + Intergenic
937263164 2:120599249-120599271 TGCCAGCGGGAAGTGGGAAGGGG - Intergenic
937318085 2:120944667-120944689 TGCCCCTGTGAAGTTGGATTGGG - Intronic
937930679 2:127202826-127202848 TGCCTCTAAAAAGAGGGATGGGG + Intronic
938029848 2:127982741-127982763 TGACAAAGCGAAGTGGGATGGGG + Intronic
938096894 2:128470160-128470182 AGTTACTGGGAAGTGGGATGGGG + Intergenic
941423328 2:165311540-165311562 TTCCTGTGAGAAGTGGGATTAGG - Intronic
943694131 2:190905343-190905365 TACCACTGGGAAGTGGGCTAGGG + Intronic
944795020 2:203175264-203175286 TTCCACTCTGAAGTTGGATGTGG - Exonic
945034083 2:205689173-205689195 TGCCACTGAGAAGTTTTGTGGGG + Intronic
946049816 2:216853241-216853263 GGTCACTTAGAAGTGGGGTGGGG - Intergenic
946072680 2:217047881-217047903 TGCCCTTAAGAAGTGGGAGGGGG - Intergenic
946168488 2:217879634-217879656 TTTCAGAGAGAAGTGGGATGAGG - Intronic
946394158 2:219434955-219434977 GGCCACTGAGAGCTGGGCTGGGG - Exonic
946714546 2:222539512-222539534 GAGCACTGAGAAGTGGGAGGTGG - Intronic
947118792 2:226797101-226797123 AGCCACTGAGGACTGGGACGGGG + Exonic
947382692 2:229560532-229560554 TGCCTCTGAGGGGTGAGATGCGG - Intronic
947872505 2:233447207-233447229 CGCCACAGAGAGGTGGGACGGGG - Intronic
948128932 2:235585988-235586010 TGCCACTGAGAAGTGTATTTAGG + Intronic
948932568 2:241141541-241141563 GGTCACTGAGAGGTGGGAGGTGG - Intronic
1168902211 20:1374630-1374652 TTACTCTCAGAAGTGGGATGAGG - Intronic
1169317953 20:4608974-4608996 TGCCCCTCAGAGGTTGGATGAGG - Intergenic
1169806989 20:9569590-9569612 TGCCACTGAGAAGTGGGATGGGG + Intronic
1170151931 20:13235564-13235586 TGCCACTGAGAAGTTAGAGCTGG + Intronic
1170404377 20:16020749-16020771 AGCCACGTACAAGTGGGATGGGG + Intronic
1170487848 20:16837912-16837934 AGCCACTAAGAAGGGGCATGAGG + Intergenic
1170807357 20:19644210-19644232 TCCCCGTGAGAAGTGGGATCTGG - Intronic
1173013667 20:39205598-39205620 TGCCTCTGACCAGTGTGATGGGG - Intergenic
1173968109 20:47129294-47129316 TGCAACAGAGTAATGGGATGTGG + Intronic
1174271981 20:49376295-49376317 TGCCCCTGCTAAGTGGGAAGGGG + Intronic
1174275986 20:49404637-49404659 TGCCAGTGAGTGGTGGGGTGGGG - Intronic
1174367963 20:50067828-50067850 TGCCATTGAAAATTGGAATGGGG - Intergenic
1174714221 20:52739587-52739609 TGCCACTGATAAGTGCTATGAGG + Intergenic
1175155942 20:56971670-56971692 TGGCCCAGAGAAGTGGGGTGTGG - Intergenic
1175306231 20:57977477-57977499 TGCCCCACAGAAGTGGGGTGGGG + Intergenic
1175986080 20:62764773-62764795 TGCCACTGTGAGCTGGGACGTGG + Intergenic
1176177811 20:63736974-63736996 AGCCAGAGAGAAGTGGGGTGGGG + Intronic
1178502194 21:33134809-33134831 TGCCACTGAGGAGTGAGAAACGG - Intergenic
1179222006 21:39416681-39416703 TGTCATTGAGAACTGGGATTTGG - Intronic
1179551227 21:42145348-42145370 TACCTCTGAGATGTGGGAAGAGG + Intergenic
1179641157 21:42747850-42747872 AGCCCCAGAGAAGGGGGATGGGG + Intronic
1181737312 22:24892152-24892174 TGGCACTGGGAATTGGGAGGTGG + Intronic
1182164601 22:28160711-28160733 TGACACTGAGGAGTGGGACAAGG + Intronic
1183228528 22:36566308-36566330 TGCCACTGGGAAGAAGGCTGGGG - Intronic
1183585693 22:38751736-38751758 GGCCACTGGGAAATGGGCTGTGG - Intronic
1183922024 22:41177316-41177338 TGAGGCTGAGAAGTGGGCTGGGG - Exonic
1184253352 22:43273346-43273368 TGCCTCTGTGAAATGGGAGGTGG + Intronic
1185186441 22:49403566-49403588 TGGCCCTGAGAAGTGGAATTAGG + Intergenic
950202161 3:11052584-11052606 TGCCACTCCGAGGTGGGGTGGGG - Intergenic
950495051 3:13328760-13328782 TGCCACTAACAGGTAGGATGTGG - Exonic
950558537 3:13709140-13709162 TACCACTGAGGAGGGGGATGAGG + Intergenic
950863207 3:16168823-16168845 TTCCCCTGAGAAGAGGGATGTGG + Intergenic
952652611 3:35744470-35744492 AGCCACTGTGCAGTGGGAAGGGG + Intronic
952998751 3:38910503-38910525 TGCCTCTAAGAAGTGGGATCAGG - Intronic
953190738 3:40685095-40685117 TGCCCCTGGGGAGTGGAATGAGG - Intergenic
955999908 3:64718186-64718208 TGCAACTGAAAATTGTGATGAGG - Intergenic
956639555 3:71402743-71402765 TGCTGCTGAGAAGTGGGAAGGGG + Intronic
958112860 3:89172329-89172351 TGCCATTGAGAGCTGGGAAGAGG + Intronic
961135321 3:124504735-124504757 TGGCAGTGAGCACTGGGATGTGG + Intronic
961981010 3:131078486-131078508 TCTCACTGAGAAATGGGATGGGG + Intronic
963044858 3:141094932-141094954 AGCCACTGAGAAAATGGATGAGG - Intronic
963585302 3:147179182-147179204 TGCCACTGAGAGATAGGTTGTGG - Intergenic
964287647 3:155137038-155137060 TGCCACTGTGAACTTGAATGAGG + Intronic
965685157 3:171294822-171294844 AGCTACTGAGATTTGGGATGGGG - Intronic
966945612 3:184775208-184775230 AGCCACTCAGAAGTGGGATGGGG + Intergenic
968432752 4:568371-568393 TGGGACTGAGAAGGGGGATGAGG - Intergenic
969455266 4:7296677-7296699 AGCCACTGAGAAGTGCGGGGAGG + Intronic
972071296 4:35021319-35021341 AGACACGGAGAAGTGGGGTGGGG + Intergenic
972460109 4:39293875-39293897 TGCCAATGAGAAGAGCCATGGGG + Intronic
973288158 4:48442690-48442712 TGAGAGTGAGAAGTGGGAGGGGG + Intergenic
974308894 4:60177604-60177626 TGCCTCTTGGGAGTGGGATGAGG + Intergenic
975102565 4:70531191-70531213 TGCCACTGGGAGTTGGGAGGCGG - Exonic
975290380 4:72671207-72671229 GGACACTGAGACTTGGGATGGGG + Intergenic
975724957 4:77282938-77282960 TGTCATTGAGTAGTGTGATGAGG - Intronic
975875813 4:78835690-78835712 TACCTCTGAGAAGAGGGATGAGG - Intronic
976230499 4:82837799-82837821 TTCCAGTGAGAAGTGGGATTGGG - Intronic
977666413 4:99650745-99650767 TGCCAGTGAGGAGAGGGAAGGGG - Exonic
979400889 4:120248010-120248032 TGGCACTGAGAAGGGGGTTGAGG + Intergenic
980000865 4:127486195-127486217 CTCCACTAAGAAGTGAGATGGGG + Intergenic
980167321 4:129244850-129244872 TGCCATTGGGAACTGGGGTGGGG - Intergenic
981429912 4:144646365-144646387 TGCGGCTGGGAAGTGGGAGGAGG - Exonic
981653087 4:147081085-147081107 TCCCACTAAGTAGAGGGATGAGG - Intergenic
982026899 4:151259956-151259978 TGCCTCTGAAGAGTGGTATGAGG - Intronic
984522505 4:180818508-180818530 TGCCTCTGGGAAGTGGGATAGGG - Intergenic
986436928 5:7743336-7743358 GGCCACCGAGATGGGGGATGTGG + Intronic
987030640 5:13973630-13973652 TGGCACAGAGCAGTGAGATGTGG + Intergenic
987993163 5:25241668-25241690 TGAGACTGGGAAGTGGGAGGCGG + Intergenic
991175903 5:63687456-63687478 TGACCCCTAGAAGTGGGATGAGG - Intergenic
995525062 5:113044153-113044175 TCCCAAGGAGACGTGGGATGGGG - Intronic
995624880 5:114065293-114065315 AGCCACTGAGAAGCCAGATGTGG - Intergenic
997015941 5:129935639-129935661 TTCCACTTAGAAATGAGATGTGG + Intronic
997663022 5:135603848-135603870 CTCCACTGTGAAGTGGGAGGTGG + Intergenic
998354662 5:141525011-141525033 TCCCGCTGACATGTGGGATGAGG - Intronic
998355848 5:141535833-141535855 TGCCTCTGAGCAGAGGAATGGGG + Intronic
998503892 5:142656840-142656862 TACCCCTGGGGAGTGGGATGGGG + Intronic
999271491 5:150298687-150298709 TACCACTGTGAGGTGGGCTGTGG + Intronic
999637214 5:153635385-153635407 AGCCAAAGAGAAGTGGGTTGTGG - Intronic
1001370595 5:171196621-171196643 AGACACTGAGCAGGGGGATGGGG + Intronic
1003478348 6:6505981-6506003 CTGCACTGAGCAGTGGGATGGGG + Intergenic
1003661868 6:8069841-8069863 AGACACAGAGCAGTGGGATGTGG + Intronic
1005243586 6:23856788-23856810 TGCCACGGAGCAGTGGGTTCTGG - Intergenic
1005582581 6:27248829-27248851 TAACGCTGAGAGGTGGGATGGGG - Exonic
1006370431 6:33640762-33640784 TGCCCCTGAGAAGTGGGGTGTGG - Intronic
1006720489 6:36147070-36147092 TGCTACTGAGAAGGAGGAAGTGG - Intergenic
1007031658 6:38633300-38633322 GGCCAGTGAGAAGTGGGACTGGG - Intronic
1007636633 6:43303637-43303659 AGCTACTGAGAGGTGGGAAGAGG + Intronic
1008489890 6:52075536-52075558 TGCAACTGAGAAGTGGATTCAGG - Intronic
1009263760 6:61528479-61528501 TGCTACTGAGAAGTTGAATAAGG - Intergenic
1011261912 6:85478481-85478503 TTTCACTGGGAAGTGGCATGGGG + Intronic
1013075313 6:106765738-106765760 TGCCACTGAGAGGTGGGTGCTGG + Intergenic
1014050502 6:116947337-116947359 TGAATCTGAGAAGTGGGCTGGGG - Intergenic
1014547957 6:122754609-122754631 TACCACTGAAAAGTGGGTGGGGG - Intergenic
1015370444 6:132445324-132445346 TGCCTCAGAGAAGTAGGCTGAGG - Intergenic
1017545825 6:155450094-155450116 CGCCATGGAGGAGTGGGATGAGG + Intronic
1019929011 7:4211139-4211161 TGACACTGAGACGGGGGATTGGG - Intronic
1021595548 7:22312568-22312590 TCCCAATGAGAAGGGGGATCTGG - Intronic
1022493840 7:30840715-30840737 TGCCAGTGAGAACTGGCCTGGGG - Intronic
1023875070 7:44282438-44282460 GGACACTGAGGAGTGGGCTGGGG - Intronic
1024330657 7:48151574-48151596 AACCACAGAGAAGTGGGATTGGG - Intergenic
1024506651 7:50167746-50167768 TGTCACTGTGAAGAGGGCTGGGG - Intergenic
1025032076 7:55565940-55565962 TGCCAGTGTTAAGTGGGCTGGGG - Intronic
1026525054 7:71146235-71146257 TCCCAGTAAGAAGTGGGCTGCGG - Intronic
1027270427 7:76515651-76515673 AGCCACTGATGTGTGGGATGGGG - Intronic
1027290058 7:76697245-76697267 TGGCAATGAGAAGTAGGATATGG + Intergenic
1028537176 7:91902636-91902658 TACCTCTGAAAAGTGGGATTCGG - Intergenic
1029022182 7:97376382-97376404 TCCCACTTATAAGTGAGATGAGG - Intergenic
1029248601 7:99220229-99220251 TGAGACTGAGAAGGTGGATGAGG + Intergenic
1029422004 7:100476730-100476752 TGTCACTGAGAAATTGGGTGGGG - Intronic
1029629679 7:101742622-101742644 TGCCCCTGAGAAGGGGGACAGGG + Intergenic
1030714281 7:112790254-112790276 TGCGACTGAGAACAGGGAGGCGG + Exonic
1031318501 7:120289275-120289297 TGCCAATGAGAATTGAAATGTGG - Intronic
1031973636 7:128080602-128080624 TGCCACGGGGAAGGGAGATGGGG + Intronic
1032414752 7:131727412-131727434 TGGCTCTGAGATGAGGGATGAGG - Intergenic
1033270950 7:139932515-139932537 TGACCCTGAGAAGTGGAATTGGG - Intronic
1033463390 7:141568125-141568147 TGCCAGTGGGAAGGGAGATGTGG + Intronic
1033578578 7:142710745-142710767 AGCCTCTCAGAAGTGGGGTGAGG + Intergenic
1033637966 7:143229722-143229744 TTCCACTGAGCAGTGAGATGAGG - Intergenic
1034354481 7:150442097-150442119 TGCTGCTGGGAAGTGGGATGCGG + Intergenic
1034531905 7:151701089-151701111 AGCCCCTGAGGAGTGGGAGGTGG - Intronic
1037324065 8:17670996-17671018 TTCCACTGTGAAATGGCATGAGG + Intronic
1039105065 8:33981289-33981311 CGTCACTGTGAAGTGTGATGGGG + Intergenic
1041189701 8:55341330-55341352 TGCCAATGAAAAGTGGGAATGGG - Intronic
1042369461 8:67974992-67975014 CCACACTGAGAAGTGGTATGAGG - Intronic
1046258732 8:111737462-111737484 ATTCACTGAGAAGTGAGATGAGG + Intergenic
1047632697 8:126725647-126725669 TGCCACTGAGAATAGTAATGAGG - Intergenic
1050286543 9:4108587-4108609 AGCCACTGGGACGAGGGATGTGG + Intronic
1050595783 9:7203370-7203392 TACCACTGAGGTGAGGGATGTGG - Intergenic
1052344841 9:27399232-27399254 CCCCACTGGGAAGTGGGATAAGG - Intronic
1054926502 9:70594542-70594564 TTCCATTGAGAAGTGGAATATGG + Intronic
1055272302 9:74574904-74574926 TACCACTGAGCAGTGTGATTGGG - Intronic
1056923726 9:90814595-90814617 TGGCACTGAGAACTGGGAAAGGG - Intronic
1057048805 9:91906426-91906448 TGCCACTAAGAAGGGTGCTGTGG - Intronic
1057850038 9:98558353-98558375 GGCTACTGAGAAGTGGGCTAAGG + Intronic
1059865795 9:118512640-118512662 TGCCACTGAGTAGTGGGTGATGG - Intergenic
1060967181 9:127717806-127717828 AGCCCCTGAGAAGTGTGAGGTGG - Intronic
1061158418 9:128879346-128879368 TGCCATCCAGGAGTGGGATGTGG + Intronic
1061609074 9:131734225-131734247 TGCCCTGGAGAAGTGGAATGGGG - Intronic
1061737281 9:132670221-132670243 TGCCTCTGAGAAGCGAGATCCGG + Exonic
1062426304 9:136507735-136507757 CTATACTGAGAAGTGGGATGGGG - Intronic
1062654252 9:137594207-137594229 GGCCAGTGAGAAGTGCAATGGGG + Intergenic
1062732132 9:138115888-138115910 AGCCCCTGAGAACTGAGATGTGG - Intronic
1186442076 X:9595107-9595129 CGCCACTGTGCAGTGGGGTGTGG + Intronic
1186462334 X:9758196-9758218 TGACACAGAGAAGCTGGATGTGG - Intronic
1190152028 X:47957012-47957034 TGCCACTGACAGGTGGGAGCCGG - Intronic
1190897630 X:54636598-54636620 TCCCACTTATAAGTGAGATGTGG + Intergenic
1190971783 X:55356810-55356832 TGCCACTGAGATGTGTGGTCTGG + Intergenic
1192321265 X:70092463-70092485 TGCAGCTGAGGAGTGAGATGGGG - Intergenic
1192337714 X:70235903-70235925 TGGCTCTGAGAACTTGGATGAGG - Intronic
1192656368 X:72999195-72999217 TGACACTTAGAAGTTGGGTGGGG - Intergenic
1192665752 X:73083806-73083828 TGACACTTAGAAGTTGGGTGGGG + Intergenic
1193078278 X:77378903-77378925 TCCCTCTGAGAAGTGAAATGAGG + Intergenic
1195930085 X:110065584-110065606 TGCTCCTGAGGGGTGGGATGGGG + Intronic
1198221085 X:134603191-134603213 TGCCTCTGAGGAGTGGGACTGGG + Intronic
1199246821 X:145614533-145614555 TGGCACAGAGGAGTGGGATAGGG - Intergenic
1199375477 X:147103105-147103127 TTCCACTTATAAGTGAGATGTGG - Intergenic
1200064841 X:153499406-153499428 TGGCACAGAGAGGTGGGAGGTGG + Intronic
1202380920 Y:24276221-24276243 AGCCTCTGGGAGGTGGGATGTGG + Intergenic
1202489864 Y:25393904-25393926 AGCCTCTGGGAGGTGGGATGTGG - Intergenic