ID: 1169807442

View in Genome Browser
Species Human (GRCh38)
Location 20:9574058-9574080
Sequence AACAGGACCAGGCTTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169807438_1169807442 2 Left 1169807438 20:9574033-9574055 CCTCACTTGACTCAAAGGAAAAT No data
Right 1169807442 20:9574058-9574080 AACAGGACCAGGCTTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169807442 Original CRISPR AACAGGACCAGGCTTGGCTT TGG Intronic