ID: 1169812495

View in Genome Browser
Species Human (GRCh38)
Location 20:9622474-9622496
Sequence TGAAGTAAACATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 8, 3: 38, 4: 379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169812495 Original CRISPR TGAAGTAAACATGAGGAGGA GGG Intronic
900558137 1:3290233-3290255 GGAAGTAGACATGGGAAGGAAGG + Intronic
900828856 1:4949557-4949579 TCAAGAAACCATGAGGAAGAGGG - Intergenic
901902688 1:12379409-12379431 TGAAGGGAACATGAGGATGATGG - Intronic
902270038 1:15297300-15297322 TGAAGCAAACTTGGGAAGGATGG + Intronic
903620055 1:24691536-24691558 TGAAGTCAACATACAGAGGAAGG + Intergenic
905205259 1:36339774-36339796 TGAAGCAAAGGAGAGGAGGATGG - Exonic
906576706 1:46897815-46897837 TGAAGAAAATATGAACAGGAAGG + Intergenic
906595212 1:47069770-47069792 TGAAGAAAATATGAACAGGAAGG - Intronic
906884359 1:49628523-49628545 TAAAGTCTACATGAAGAGGATGG + Intronic
908487759 1:64611728-64611750 TGAAGAAAACAGGAAGATGAGGG - Intronic
909070603 1:70988951-70988973 GGGAGTTAACATGAGGAGGCTGG + Intronic
909719458 1:78750632-78750654 TGAAGGCAAGAAGAGGAGGAAGG + Intergenic
911248183 1:95543113-95543135 GGAACTAAACATGAGGGTGAAGG - Intergenic
911389757 1:97226341-97226363 TGGAGTAAAAATGAGGAGAGTGG - Intronic
912188801 1:107313751-107313773 TGAAGAAAACATCAACAGGAGGG - Intronic
912243630 1:107938302-107938324 TCAAGGAAAGCTGAGGAGGAAGG + Intronic
913215355 1:116615535-116615557 TGAAGGAAACATGAGGAAGAGGG - Intronic
913291116 1:117273118-117273140 GGAAGGAAAGATGTGGAGGAGGG - Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
913561110 1:120020844-120020866 TCACGTAAATATGAGGAGAAAGG - Intronic
913637017 1:120772758-120772780 TCACGTAAATATGAGGAGAAAGG + Intergenic
913939860 1:125091637-125091659 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
913979215 1:143493455-143493477 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914043606 1:144072789-144072811 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914073618 1:144319105-144319127 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914105537 1:144647255-144647277 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
914134481 1:144887702-144887724 AAAAGTAAAAAGGAGGAGGAGGG + Exonic
914281694 1:146180256-146180278 TCACGTAAATATGAGGAGAAAGG - Intronic
914542738 1:148631192-148631214 TCACGTAAATATGAGGAGAAAGG - Intronic
914623896 1:149440052-149440074 TCACGTAAATATGAGGAGAAAGG + Intergenic
916439656 1:164810745-164810767 AGAGGTAAACTGGAGGAGGAAGG - Intronic
916682113 1:167114211-167114233 TGAAGGATGCATGGGGAGGAGGG + Intronic
917894270 1:179472637-179472659 TGAAGCAAACATCAAGAGAAAGG - Intronic
918077616 1:181182408-181182430 GGAAGAAAACAGGGGGAGGATGG - Intergenic
918226506 1:182488368-182488390 GGAAGGAATCATGAGGATGAGGG + Intronic
918553664 1:185773524-185773546 TGAAGCCAACATGTAGAGGAGGG + Intronic
918666968 1:187163605-187163627 TAAAGAAAACTTGAGGGGGATGG - Intergenic
918934743 1:190907039-190907061 TGAAGTAAACTTGAAAAAGAAGG + Intergenic
919550109 1:198975196-198975218 TGAAGGGGACAGGAGGAGGAAGG + Intergenic
919659187 1:200226824-200226846 TTAAGTACAGATGATGAGGATGG - Intergenic
920723539 1:208412430-208412452 TTAAGTAAACAAGAGGACAAGGG - Intergenic
921123080 1:212153459-212153481 TTAAGTGATCATGAGGAGTAGGG + Intergenic
921209306 1:212879208-212879230 TGAAGGAATTATAAGGAGGAAGG + Intronic
922142336 1:222901220-222901242 TGAACCAAACTTGAGGACGAAGG + Intronic
922171967 1:223163139-223163161 TGAGGAAAACATCAGGAGTAAGG - Intergenic
922391028 1:225141572-225141594 AGAAGTAAAAATGAGGTGGAGGG - Intronic
924176983 1:241401060-241401082 AGAAATGAACATGGGGAGGAAGG + Intergenic
1062813632 10:483558-483580 TGAGGAAAACAGGAGAAGGACGG - Intronic
1063411782 10:5841885-5841907 TGATGTATACATGAAGGGGATGG - Intronic
1064454084 10:15470464-15470486 TGAAATAACCATGGGGAAGAAGG - Intergenic
1064939910 10:20722766-20722788 AGAAGTCAACAAGAGGAGGTTGG + Intergenic
1066780275 10:38938148-38938170 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1066956023 10:42173434-42173456 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1067163766 10:43848718-43848740 TGAAGAAAATAAGATGAGGAGGG + Intergenic
1067219411 10:44333078-44333100 TGAAATAAATTTGAAGAGGAAGG + Intergenic
1067295495 10:44973168-44973190 AGAAGTGAGCATGAGGAGGTGGG - Intronic
1068659603 10:59610594-59610616 TAAACTAAACATATGGAGGATGG - Intergenic
1071501151 10:86205056-86205078 TGAAATAAAGATGAGGTGGATGG - Intronic
1073066749 10:100764921-100764943 GGAGGTAAACAGGAAGAGGAGGG + Intronic
1073805327 10:107091405-107091427 TCATATAAACAGGAGGAGGATGG + Intronic
1074292296 10:112147229-112147251 GGAAGTAAAAATGAGGGAGAGGG - Intergenic
1074339140 10:112609408-112609430 TGTAGTAATGATGAAGAGGATGG + Intronic
1074833582 10:117267540-117267562 TGAAGAAAACAGGAGGAAGAAGG - Intronic
1075282633 10:121153541-121153563 TGGAGAAAACATGAGAAGAATGG + Intergenic
1078703362 11:13712869-13712891 TCAAGAAGACATGAGGATGATGG - Intronic
1079436626 11:20460168-20460190 GGAAATAAACGTTAGGAGGAAGG + Intronic
1080357410 11:31466443-31466465 TGCAATAAACATGAGGATGCAGG - Intronic
1080428867 11:32180198-32180220 TGCAGTAAAGAGGAGGAGGGAGG - Intergenic
1083432726 11:62622723-62622745 TAAAGGAAAAATGAGAAGGATGG - Intergenic
1083818453 11:65151332-65151354 GGAAGGAAAAATGAGGAGGCAGG - Intergenic
1084566724 11:69932858-69932880 TGAAGTAATCAAGAGGAAAAGGG + Intergenic
1084849881 11:71930061-71930083 TGAAGGAATCACTAGGAGGAAGG + Intronic
1086326757 11:85709236-85709258 TAAAGTAATCAAGAGGAGGGAGG - Intronic
1087007349 11:93483061-93483083 TGAACTCAACAAGAGGAGGTAGG + Intronic
1087425952 11:97985975-97985997 TGAAGCAAATCTGAGAAGGAAGG - Intergenic
1088868418 11:113870879-113870901 AAAAGCAAACAAGAGGAGGAAGG + Intronic
1089073655 11:115719812-115719834 AGAAGTAATTTTGAGGAGGAAGG - Intergenic
1089121166 11:116136576-116136598 TGAAGTAAAGATTAGGAGTGTGG - Intergenic
1089875588 11:121718561-121718583 TGATTTACACATGAGGACGATGG + Intergenic
1090431878 11:126653143-126653165 TTAAGTAAACAAGAGAATGATGG + Intronic
1090537935 11:127665784-127665806 TGCACTAAACATGAGGAGTATGG + Intergenic
1090861236 11:130654415-130654437 GGAAGTAAGCATGAGGATAATGG - Intergenic
1090924990 11:131241630-131241652 AGAAGTAGACATGAGTAGGGAGG + Intergenic
1091137541 11:133205422-133205444 TGAATTAAACCTGAAGAGGTGGG + Intronic
1091840697 12:3618529-3618551 TCAAGGAAAAAGGAGGAGGAAGG - Intronic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1092571025 12:9721136-9721158 TGAAGGAAAAAGGAGAAGGAGGG - Intronic
1093534948 12:20211463-20211485 TGAATTAAACATTATGAAGAGGG - Intergenic
1093681099 12:22004444-22004466 TGCAATAAACATGAGGACGCAGG + Intergenic
1095537451 12:43268090-43268112 TGAAATACACTTGAGCAGGAAGG - Intergenic
1096029055 12:48395531-48395553 TGAAGTAATGATGGGGATGATGG - Intergenic
1096070785 12:48774417-48774439 AGAAGTAAACACAAGCAGGACGG + Exonic
1097290437 12:57909946-57909968 AGAAGAAAAAAAGAGGAGGATGG + Intergenic
1099046479 12:77727053-77727075 AGAAGGAGACATGAGGAGGTGGG + Intergenic
1099153896 12:79150616-79150638 CCAAGTGAACATGATGAGGAGGG + Intronic
1099362645 12:81724779-81724801 TGCAATAAACATAAGGGGGAAGG + Intronic
1100024872 12:90115752-90115774 TGAAATAAACATGAGGATGAAGG + Intergenic
1100591671 12:96035606-96035628 AGAGGTAAAGAAGAGGAGGAGGG + Exonic
1100722680 12:97375283-97375305 TGAACTAATCACGAGGAGGTTGG - Intergenic
1101302174 12:103494501-103494523 TAAAATAAAAAGGAGGAGGATGG + Intronic
1101614723 12:106325344-106325366 TGAAGTTGAGATGAGGAGGAGGG + Intronic
1102062601 12:109945031-109945053 TGACGTGAACATGAGCAGTATGG + Intronic
1103590771 12:121990493-121990515 GGAAACAAGCATGAGGAGGAGGG - Intronic
1104181639 12:126387116-126387138 TGCAGGAAACAGGAGGAAGATGG - Intergenic
1104308071 12:127627827-127627849 TGAAGTGTACCTGAGGAGGAGGG - Intergenic
1104514533 12:129412514-129412536 TGTAGGAAGAATGAGGAGGAGGG - Intronic
1105219090 13:18309012-18309034 TGAAGGAAACATGAGGAAGAGGG - Intergenic
1105635464 13:22211593-22211615 TTAGGTAAAGATGAGAAGGATGG + Intergenic
1106477308 13:30109427-30109449 TGCAGGGAACATAAGGAGGAGGG + Intergenic
1106867494 13:33982124-33982146 TGAATAAAACTTGAGAAGGAGGG - Intergenic
1107067471 13:36230630-36230652 GGAAATAAACATGAGGTGAAGGG + Intronic
1108470829 13:50765412-50765434 GGAAGAGAAAATGAGGAGGAAGG + Intronic
1108478053 13:50840919-50840941 TGAAGAAGGCTTGAGGAGGATGG + Intronic
1109552134 13:63917672-63917694 GGAAGGAAACAAGAGAAGGAAGG - Intergenic
1109680961 13:65751631-65751653 GGAAGCAAACAAGAGGAGAAAGG - Intergenic
1110001351 13:70206207-70206229 TGCAGTAAAAATAAGGAAGAGGG + Intergenic
1110088349 13:71411333-71411355 TGAAGCAAACAGGAAGAAGAAGG - Intergenic
1110434483 13:75464065-75464087 TGAAGTTAACATACTGAGGAGGG - Intronic
1110519218 13:76455791-76455813 AGAAGAAAAGAGGAGGAGGATGG + Intergenic
1110839383 13:80124213-80124235 GGAAGAAAAAAAGAGGAGGAAGG + Intergenic
1113159635 13:107365110-107365132 TGAGGCAAAGATGAGGAAGAAGG - Intronic
1113332221 13:109340638-109340660 TTAAGTTAACATGATGAGAATGG - Intergenic
1114360291 14:21964676-21964698 TACAATAAACATGAGGAGGCAGG + Intergenic
1114460653 14:22884256-22884278 TGCTGGAAACAGGAGGAGGAAGG + Intronic
1114552112 14:23538711-23538733 TGAAGGAGGCAAGAGGAGGAAGG + Intronic
1117018800 14:51548438-51548460 TGCAGTAAACATGATCATGATGG + Intronic
1117498308 14:56327627-56327649 TGAAGTCAACATGCAGAGGAGGG - Intergenic
1118339614 14:64883257-64883279 TAAAGGATACAAGAGGAGGAGGG + Intergenic
1119070117 14:71574265-71574287 AGAATAAAACAGGAGGAGGAAGG + Intronic
1119832764 14:77718093-77718115 TGAAGGCAAGAAGAGGAGGAAGG - Exonic
1120394220 14:83947281-83947303 TGCAGTAAACATGAGGATGCAGG + Intergenic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1123392900 15:19895243-19895265 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1124452384 15:29807485-29807507 TCAGGTAGACAGGAGGAGGAAGG + Intronic
1124723797 15:32136734-32136756 TGAAGAAAACAGGAGAAGGCCGG + Intronic
1124833286 15:33170934-33170956 TGCAGTAAACATGAGGGTGCAGG - Intronic
1125094083 15:35830884-35830906 TGATGTAAACATGAGGGAGCTGG + Intergenic
1125280752 15:38040238-38040260 AGAAGTAAACATCAGGAGGCTGG + Intergenic
1126107579 15:45156811-45156833 TGAAGGGAACATGAGAAGGGAGG - Intronic
1126222593 15:46231616-46231638 TGAAGTAAATATAAGCAGCAAGG - Intergenic
1126703462 15:51386944-51386966 TGAAGTATACAGGAGGAGGTGGG + Intronic
1127978040 15:64013511-64013533 TTAAGAAAACATGAGGAGAAGGG + Intronic
1128533624 15:68472696-68472718 TGAACTCAACAGGAGGAGGCAGG - Intergenic
1128542936 15:68549564-68549586 TGAAGGGACCATGGGGAGGATGG + Intergenic
1128586165 15:68852410-68852432 TAAAATAAACATGAAGAGAAAGG + Intronic
1128761818 15:70221683-70221705 TGAAATTAACATGATGATGATGG - Intergenic
1130600974 15:85272947-85272969 TGAAGGCAAGAAGAGGAGGAAGG + Intergenic
1130663989 15:85853943-85853965 TGAAGTAAGCATGAGGTGGCTGG + Intergenic
1130805421 15:87316005-87316027 AGAAGAAAAGATGTGGAGGAAGG + Intergenic
1130833973 15:87631199-87631221 TGATATAAACCAGAGGAGGAAGG + Intergenic
1131141339 15:89979012-89979034 TGAAGTGAACTTGAGGAGCTGGG + Intergenic
1131282210 15:91031248-91031270 TGAAGGCAAGAAGAGGAGGAAGG - Intergenic
1131535131 15:93231161-93231183 TGAAGAAGTCATGAAGAGGAAGG - Intergenic
1132027475 15:98415652-98415674 AGAAGGAAACAAGAGGAGGAGGG + Intergenic
1134331345 16:13253929-13253951 TGAAGAAAACAGGAAGTGGAAGG - Intergenic
1134333476 16:13271741-13271763 TGAACTCAAAATGAGGATGAGGG + Intergenic
1134645987 16:15866697-15866719 TGAAGTAAGCATGAAGAGACAGG - Exonic
1134839821 16:17392846-17392868 TAAAGTAAACATAAAGTGGAGGG - Intronic
1135832636 16:25789523-25789545 AGAAGAAAAAAAGAGGAGGAGGG - Intronic
1135929102 16:26721635-26721657 CAAACTCAACATGAGGAGGAGGG - Intergenic
1136799203 16:33055254-33055276 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1136956881 16:34798203-34798225 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1137416859 16:48290538-48290560 TTAAGCAAACCTGAGGAGGGGGG - Intronic
1138339425 16:56279041-56279063 TGAAAAAAACATGAGAGGGAAGG - Intronic
1138712422 16:58984681-58984703 TAAAGAAAACATGAAAAGGAAGG + Intergenic
1139028720 16:62852743-62852765 TGAACTAAAGAGCAGGAGGATGG + Intergenic
1139416842 16:66819238-66819260 TGAAGACCACAAGAGGAGGAAGG - Intronic
1140032731 16:71351260-71351282 TGAACTAACCAGGAGGAGGGAGG - Intergenic
1141359014 16:83377221-83377243 TGAATTAAACATAAAAAGGAGGG + Intronic
1143829888 17:9642853-9642875 TGCAGTAAATTTGAAGAGGAGGG - Intronic
1144518960 17:15941779-15941801 TTCAGGAAACACGAGGAGGAAGG - Intergenic
1145093843 17:20008566-20008588 TGAAGCTCAAATGAGGAGGAAGG - Intergenic
1146516861 17:33496222-33496244 GGAAGTAAACATGAAGAGAAAGG + Intronic
1147212741 17:38881507-38881529 GGAAGAAAACACGAGGAGGCTGG - Intronic
1147272247 17:39282515-39282537 AAAAATAAACTTGAGGAGGAGGG - Intronic
1149302921 17:55321212-55321234 TGAAGCAAAGCTGAGGAGGCAGG - Exonic
1150008041 17:61481708-61481730 TGGAGAAAACAGGAGGAGGGAGG + Intronic
1150554109 17:66238189-66238211 TGAAGCATACATTAGAAGGAAGG + Intronic
1151690729 17:75683478-75683500 TGAAGAAAATATGAGAATGAGGG - Intronic
1155059951 18:22219647-22219669 TGATGTAAAAATGGGGTGGAAGG - Intergenic
1155268262 18:24114946-24114968 TCAAGTAAACATTAGTGGGAAGG - Intronic
1155643256 18:28045666-28045688 TGAAGCACACATGTGGGGGAGGG - Intronic
1155697326 18:28698377-28698399 TGGAGTAAAGAGCAGGAGGACGG + Intergenic
1155999133 18:32365553-32365575 GGAAGTAGAAAAGAGGAGGAAGG + Intronic
1156176167 18:34549083-34549105 TGAAGAAAACACCAGGAGGCAGG - Intronic
1156277150 18:35594316-35594338 TGAGGTAAAAGTGAGGTGGAAGG + Intronic
1156489303 18:37486853-37486875 AGAAGTGAACATGGGGAAGAGGG - Intronic
1159022764 18:63156629-63156651 TTACGTAAACATCAGGTGGACGG - Intronic
1163288409 19:16363652-16363674 TGAAGTGGAAATGAGAAGGAGGG + Intronic
1163498270 19:17659793-17659815 TGAAGAAAACATGAGAAGTACGG + Intronic
1164149821 19:22541404-22541426 TGATGGAAACAAGAAGAGGAGGG - Intergenic
1164481933 19:28618330-28618352 TGAAGAAAACATGGGGCTGAAGG + Intergenic
1165940036 19:39410327-39410349 GGAAGTGAAAAAGAGGAGGAAGG - Intergenic
1167608345 19:50493582-50493604 TGCAGGAAAGAGGAGGAGGAAGG - Intergenic
924960775 2:32614-32636 TTAAGTAAACATGGGGATGAGGG + Intergenic
925060060 2:884166-884188 TGTGGTAAAGATGAGGACGAGGG + Intergenic
925420712 2:3708772-3708794 TGAAGTAACCAAGTGGCGGAAGG + Intronic
927032560 2:19137613-19137635 TGAAGCAACCAGGAGGGGGAGGG - Intergenic
928251149 2:29681770-29681792 TGAAATAAAGATGAGGTTGAGGG - Intronic
928425973 2:31177989-31178011 TGTAGGAAACATGAGGCGGTAGG - Intronic
929861764 2:45684300-45684322 TGAAGAAACCATGAGGAGATGGG + Intronic
930799579 2:55429141-55429163 TGAAATATAAGTGAGGAGGATGG - Intergenic
931062680 2:58548578-58548600 TAAAGTAAAGATGGGGAGAAGGG - Intergenic
931644821 2:64412296-64412318 TGAATTAAACATGAAGAGTAGGG - Intergenic
934184967 2:89663501-89663523 TGAAGGGAACATGAGGAAGAGGG + Intergenic
934189312 2:89771658-89771680 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934295235 2:91737624-91737646 TGAAGGAAACATGAGGAAGAGGG + Intergenic
934303943 2:91805369-91805391 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
934329311 2:92047381-92047403 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934467530 2:94277302-94277324 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
938209945 2:129459045-129459067 TGAAGTTAAAATGAGGCTGAGGG - Intergenic
938518670 2:132042410-132042432 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
938666724 2:133546445-133546467 TGGAGTATACATGAGCAGGACGG - Intronic
938895117 2:135742061-135742083 TGAGGTATACAAGAGGATGAAGG - Intronic
939042954 2:137214262-137214284 TGTTGTAAACATAAGGAAGATGG - Intronic
940110594 2:150148298-150148320 TGAAGGAAAAAGAAGGAGGAAGG + Intergenic
942023365 2:171889080-171889102 TGAAGTAGGAAGGAGGAGGAGGG - Intronic
942081503 2:172403490-172403512 TGAAGTAAACAGAAGGAAGCTGG + Intergenic
942395961 2:175549901-175549923 AAAAGTAAACAGGAAGAGGAAGG - Intergenic
942664566 2:178303863-178303885 GGAAGTAAAGAAGATGAGGAGGG - Intronic
943184702 2:184592815-184592837 TTAAGTAAAGATGGGGAGGAGGG - Intergenic
943277506 2:185886041-185886063 TGAAGTAAGAATGAGGTGAATGG + Intergenic
944995449 2:205288616-205288638 GGAAATAAACATGAGTAGAAAGG - Intronic
946295820 2:218782623-218782645 TGAGATAAACAGGACGAGGAAGG + Intronic
947610378 2:231521644-231521666 TGAACTCCACAGGAGGAGGAGGG + Intergenic
947838483 2:233191740-233191762 TGAACAAAGCATGAGGAGGGAGG + Intronic
947921111 2:233875187-233875209 TGCAGTAAACATTAGTGGGAAGG - Intergenic
1168804769 20:665870-665892 TGAAGTGAGCAGGTGGAGGAGGG + Intronic
1169026404 20:2375099-2375121 TCAAGTAAAGATGAGGCTGAGGG - Intergenic
1169068856 20:2709550-2709572 TGAAGGAAAGATGAGGAAGGAGG - Intronic
1169070923 20:2729860-2729882 TGAAGGAAGCAGGAGGAGGCAGG + Intronic
1169105890 20:2994173-2994195 TTAAGAAAAGATGAGGAGGGAGG + Intronic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1171335192 20:24379268-24379290 TGAAGAAAAGAAGGGGAGGAAGG - Intergenic
1172455259 20:35066506-35066528 TGAAGTGAACATGAGGGAGAGGG - Intronic
1173040540 20:39458381-39458403 TGAGGTAAAGAAGATGAGGATGG + Intergenic
1173142764 20:40498652-40498674 TGAATTCAAGAAGAGGAGGAAGG - Intergenic
1173225434 20:41159883-41159905 TGAAGTGAACATGTGGATCAAGG + Exonic
1176743045 21:10623740-10623762 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1176881459 21:14199706-14199728 TCCAGAAAAAATGAGGAGGAGGG + Intronic
1177020085 21:15844024-15844046 TGAAGTAAAGATGAGGTAGTAGG - Intronic
1177607073 21:23394320-23394342 TGAACTAAAGATGAAGAGGATGG + Intergenic
1178172391 21:30056317-30056339 TGAAGTCACCATGAAGAGAATGG + Intergenic
1178673074 21:34608936-34608958 TGAAGTCTACATGAGGAGGCTGG - Intronic
1180534277 22:16383083-16383105 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1180782173 22:18527083-18527105 TGCAGAAAACATGAAGATGAGGG - Intergenic
1180816685 22:18793868-18793890 TGAAGGAAACATGAGGAAGAGGG - Intergenic
1180933059 22:19606312-19606334 AGAAGTAAGGATGAGGATGATGG + Intergenic
1181202876 22:21228215-21228237 TGAAGGAAACATGAGGAAGAGGG - Intergenic
1181239062 22:21466421-21466443 TGCAGAAAACATGAAGATGAGGG - Intergenic
1181906921 22:26205425-26205447 TAAGGTAAACCTGAGGAAGAAGG - Intronic
1181972072 22:26698424-26698446 AGAAGTAAAGAAGATGAGGAGGG - Intergenic
1181974761 22:26720995-26721017 TGAAGTCCACATGGGGAGAAGGG + Intergenic
1182266505 22:29120015-29120037 TGAAGGAAACAGAGGGAGGAAGG + Intronic
1182857321 22:33529289-33529311 TGAGGGACACATGAGCAGGAGGG - Intronic
1183251196 22:36731687-36731709 TGGACTGAGCATGAGGAGGATGG - Intergenic
1183659819 22:39212741-39212763 TGAAGTACAGATGTGGAGAAAGG + Intergenic
1184150775 22:42637215-42637237 TGAAGGAAGCAAGAGAAGGAAGG - Intronic
1203224043 22_KI270731v1_random:67211-67233 TGAAGGAAACATGAGGAAGAGGG + Intergenic
1203266784 22_KI270734v1_random:19589-19611 TGAAGGAAACATGAGGAAGAGGG - Intergenic
1203289589 22_KI270735v1_random:21714-21736 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203315366 22_KI270737v1_random:2713-2735 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
949257279 3:2063702-2063724 TAAAGTGAACATGGTGAGGAAGG - Intergenic
950944733 3:16933474-16933496 TGAAGTCAAAATGGGGAGAAAGG - Intronic
951119014 3:18901545-18901567 AGGAGTGAACATCAGGAGGAGGG + Intergenic
951251838 3:20402898-20402920 TGAATTAAAATTGAGGGGGAAGG + Intergenic
951809776 3:26686403-26686425 TGAAGTTACCATAAGGAGCATGG - Intronic
951816114 3:26756915-26756937 TGTAGTAAACATATGGAGGTTGG + Intergenic
952088025 3:29850154-29850176 AGAAGTAATCCTGGGGAGGAGGG + Intronic
952140529 3:30473880-30473902 TGAAGCAAATATGATGAGGCAGG + Intergenic
954991079 3:54841233-54841255 TTAAGTAAAAATGAGGCCGAAGG - Intronic
955440277 3:58947552-58947574 TGAAGTACACATGAAGCAGAAGG - Intronic
956198815 3:66684013-66684035 AGAAGAAAAGAGGAGGAGGAAGG - Intergenic
956514517 3:70032245-70032267 TCAAGCAAACAGGAGGAGAAGGG + Intergenic
956545453 3:70396089-70396111 AGGATTAAACATGAGGATGAAGG + Intergenic
956693563 3:71899985-71900007 TGAAGGAAAGAAGGGGAGGAGGG - Intergenic
960482781 3:118213598-118213620 TGAAGTAAATTTGGGGAGCATGG - Intergenic
962689761 3:137882498-137882520 TGTAGTAAACATGAGAATGCAGG - Intergenic
964401224 3:156301057-156301079 TGAACTAATCATGAGGAGCTCGG - Intronic
964479449 3:157127375-157127397 TTAAGTAAAAATCAGGGGGAGGG + Intergenic
964568155 3:158081025-158081047 TGAAGTGAGGATGAGGAGAAGGG + Intergenic
964686634 3:159403177-159403199 AGAAGCAAAAATGAGGAGGGTGG + Intronic
965712342 3:171568119-171568141 TGAATAAAACATGTGGAAGAAGG + Intergenic
967006132 3:185384415-185384437 TGCAGTAAACATGGGGATGCAGG + Intronic
967466752 3:189815097-189815119 TGAAGGAAAAAAGAGAAGGAGGG - Intronic
968177894 3:196567346-196567368 TGAAAAAGACATGAGGAGAAGGG + Intronic
970631912 4:17956349-17956371 TGCAGTAAACATGGGGATGCAGG - Intronic
970752797 4:19384931-19384953 TGAAATAAACATCAGGAAAATGG + Intergenic
971833143 4:31724819-31724841 TGAAGTCAACATATGGAAGAGGG + Intergenic
971994228 4:33943318-33943340 TAAAGTCAACATGAGGAGATGGG - Intergenic
972089385 4:35260952-35260974 TGAATTAATCAAAAGGAGGATGG - Intergenic
973717732 4:53693802-53693824 AGAAGCAGACATGAGGAAGAGGG + Intronic
973839520 4:54846645-54846667 TGAAGTGAAAATGAGGACGGGGG - Intergenic
974393749 4:61308255-61308277 AGAAGCAAACACCAGGAGGAGGG + Intronic
975289540 4:72660752-72660774 TAAAGTAAGCATCAGGAGTAAGG + Intergenic
975890659 4:79023302-79023324 TGAAATAATCATGATGAGAAAGG - Intergenic
976878233 4:89884274-89884296 ATAAGTAAACTTGAGGAGGATGG + Intronic
977158101 4:93599359-93599381 TGAAGTACACCTGAAGAGGCTGG - Intronic
977407211 4:96615238-96615260 TGAGGTAAACATGAAGAATAAGG - Intergenic
977912413 4:102552856-102552878 TGATGTAAACAAAAGTAGGAAGG - Intronic
978856968 4:113404401-113404423 CCAGGTAAACATGAGGAAGATGG + Intergenic
982068891 4:151677934-151677956 TGAAGGAAGAAGGAGGAGGAGGG - Intronic
983857433 4:172663077-172663099 AGCAGTAAACATGTGGAGGGTGG + Intronic
984247396 4:177291637-177291659 GGAAGTCATCATGAGGAGGACGG + Intergenic
984292285 4:177810353-177810375 TGAAATGAACGTGTGGAGGATGG + Intronic
984700316 4:182814793-182814815 TGGAGTAAAGAGCAGGAGGACGG - Intergenic
987171977 5:15268797-15268819 TTAAGTAAACAAGAGGGGTATGG + Intergenic
988054873 5:26081500-26081522 TGAAGTAAACATAATCAGAAAGG - Intergenic
988403844 5:30798527-30798549 TGAAGTACAGAAGAGGAAGACGG + Intergenic
991335404 5:65541206-65541228 TTAATTAAACCTGAGGAGGAGGG + Intronic
991979778 5:72218882-72218904 GGAAGGAATCCTGAGGAGGAGGG + Intergenic
993874975 5:93295801-93295823 GGAAGTAAACAGGAAGAGAAAGG + Intergenic
995685494 5:114767529-114767551 TGGAGTACAAATGAGGAGGAAGG + Intergenic
995803103 5:116021061-116021083 TGAAGTTGACAAGAGCAGGAAGG + Intronic
996446174 5:123554170-123554192 TGAAATAAAGATGTGGAGTAGGG + Intronic
996786532 5:127242865-127242887 TGAAGGAAAGATTAGGATGAGGG + Intergenic
998071298 5:139199854-139199876 TGAAGTAAACATAATCAAGAAGG - Intronic
1000887119 5:166759803-166759825 AGCAGTAAAGATGAGGAGGAAGG - Intergenic
1001107564 5:168868186-168868208 TGAAGGATGCATGAGGATGAGGG + Intronic
1001684462 5:173583069-173583091 AGAAGTAAAAATGAGGCAGAGGG - Intergenic
1002042302 5:176523518-176523540 AGAAGAAAAGAAGAGGAGGAGGG - Intergenic
1002496891 5:179621651-179621673 TGATGTAGACATGAGTAGCAAGG - Intronic
1002794792 6:463656-463678 AGACGGAAAGATGAGGAGGAAGG + Intergenic
1003781126 6:9428294-9428316 GGAAATAACCATGAGGAGAAAGG + Intergenic
1004154042 6:13151346-13151368 TGAAGTAAAGATGAAGAAGTTGG - Intronic
1004504939 6:16239641-16239663 AGGAGTAAACACGAGGAGGCTGG + Intronic
1004542874 6:16568594-16568616 TGAAGAAATCATGAGGAGGTGGG + Intronic
1004792855 6:19047454-19047476 TGATTTAAAAATTAGGAGGAAGG - Intergenic
1004811149 6:19264881-19264903 TCAAGTAAACATGACCTGGAAGG + Intergenic
1004908761 6:20261466-20261488 TGAAGTAAACATGGGGAAATGGG - Intergenic
1007835364 6:44669856-44669878 TCCTGTAAACAAGAGGAGGAAGG + Intergenic
1008495935 6:52134153-52134175 AGAAGTGAACATGAGGAGTGGGG - Intergenic
1008831039 6:55762365-55762387 TGAAGTAACCATGAGAAGCAAGG - Intronic
1010005345 6:70989965-70989987 TGAAAAAAACCTGAGGATGAAGG + Intergenic
1010385792 6:75278005-75278027 TGAAGAAAACAAGAGGAAGATGG + Intronic
1011538190 6:88401067-88401089 TGGAGTTGACATGGGGAGGAGGG - Intergenic
1011552160 6:88539778-88539800 TTAGGAAAACAAGAGGAGGAAGG + Intergenic
1012805003 6:103882791-103882813 TGAAATAAACATTTGGATGAAGG - Intergenic
1013006774 6:106081277-106081299 GGACTTAAAAATGAGGAGGAGGG - Intergenic
1013301160 6:108805997-108806019 TGAAGTAGAAATGAGGAAGTGGG - Intergenic
1013514335 6:110872185-110872207 TGAAGGAGAGATGAGGAGGTAGG + Intronic
1014495042 6:122111094-122111116 GAAAGCAATCATGAGGAGGAGGG - Intergenic
1014696827 6:124632297-124632319 TGAAATAAAAATGAGTAGGAAGG + Intronic
1014972547 6:127835373-127835395 TGAAGTATACATGTTAAGGAAGG - Intronic
1015683517 6:135834206-135834228 TAAAGAAAACCTAAGGAGGACGG - Intergenic
1016869263 6:148800343-148800365 TGAAGTAAAAATGTGAAGTAAGG - Intronic
1017941449 6:159056801-159056823 AGAAGTCAACATGAGGAGACTGG + Intergenic
1019890666 7:3943405-3943427 TGAAGCACAAATGGGGAGGACGG - Intronic
1020519455 7:9168343-9168365 AGAAGTAAACTTCAGGAGGTGGG - Intergenic
1021029267 7:15709733-15709755 TCAAGTAAACCTGAGAAGCAGGG - Intergenic
1021916234 7:25435371-25435393 AGAAGGGAACCTGAGGAGGATGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022847139 7:34221662-34221684 GGAAATAAACATGACCAGGAAGG + Intergenic
1024864088 7:53882868-53882890 TAAAATAAACCTAAGGAGGATGG + Intergenic
1025307290 7:57873029-57873051 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1026264931 7:68788011-68788033 TGAAGTAAACATCTGCAGGATGG + Intergenic
1027398103 7:77777949-77777971 AGAAGTAAATATGAGGAAAAGGG - Intronic
1027702997 7:81492254-81492276 TCATGAAACCATGAGGAGGAAGG - Intergenic
1027734075 7:81909966-81909988 AGAAGATAACATGTGGAGGACGG - Intergenic
1028002217 7:85513712-85513734 TGCTGTAAACAGGAAGAGGATGG - Intergenic
1028459274 7:91072336-91072358 TGGAGTGAACTTGAGGAGGCTGG - Intronic
1028870008 7:95760015-95760037 GGAAGGAAACATAAGGATGAGGG + Intergenic
1031448529 7:121884959-121884981 TGTAGTAAAAATGACGGGGAGGG - Intronic
1031795696 7:126172294-126172316 TGTTGTAAACATGTGGTGGAGGG - Intergenic
1033773676 7:144582432-144582454 TTAAGTAAACATGAGAGTGAAGG - Intronic
1035096480 7:156360153-156360175 TGAGGTAAATGAGAGGAGGACGG - Intergenic
1037005115 8:13768476-13768498 TGAAATAAGCATGAGAATGAAGG + Intergenic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1038169298 8:25114250-25114272 GGAAGGAAACATTAGGGGGATGG + Intergenic
1039382932 8:37102809-37102831 TGGAGGAAACAGGAGGAGCATGG - Intergenic
1039791783 8:40882030-40882052 TGAAGGAAAGGTGAGGAGGGAGG + Intronic
1040840765 8:51781929-51781951 GGAAGTCACCATGAGGAGGATGG - Intronic
1043531771 8:81159157-81159179 TGGAGAGAACATCAGGAGGAAGG - Intergenic
1044337899 8:91009819-91009841 TGAAATAAAAATGAAGAGAAAGG - Intronic
1045283367 8:100769090-100769112 TGCAGTAAACATGGGGGAGAAGG - Intergenic
1045490131 8:102661856-102661878 GGATGTAGACATGAGGAAGAGGG + Intergenic
1045632045 8:104135792-104135814 TTAAGTATAAATGAAGAGGAAGG + Intronic
1045734798 8:105282207-105282229 TTATGTAAACCTTAGGAGGAAGG - Intronic
1046052661 8:109042880-109042902 TAAAGCAACCATCAGGAGGAGGG + Intergenic
1046371741 8:113317971-113317993 TGAAGTTATCATTAGGAGAATGG - Intronic
1047408781 8:124607190-124607212 TGCAGTAAAAATGGGGAAGAGGG - Intronic
1048565306 8:135589785-135589807 CTAAGTAAATATGCGGAGGATGG + Intronic
1048764964 8:137833801-137833823 TGAAGGAAACATTAGTAGGAGGG - Intergenic
1048874768 8:138828051-138828073 CGAGGAAAACATGGGGAGGATGG - Intronic
1049973441 9:841180-841202 AGAATTAAATATGAGGTGGAAGG - Intergenic
1053943951 9:43285582-43285604 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1054887929 9:70219403-70219425 AGAAGTAAGAATGAGTAGGAAGG - Intronic
1055073033 9:72186925-72186947 TGAATTAGACATGAGAAGGGAGG - Intronic
1055596766 9:77873572-77873594 AGAAGTAAAAAGGGGGAGGAAGG + Intronic
1055950964 9:81729302-81729324 TTAAGTCAACATTAGGAGGTGGG - Intergenic
1056153092 9:83807115-83807137 TGAACTAAACATAATGTGGAAGG - Intronic
1057155451 9:92834264-92834286 TGCAATAAACATGAGGATGCAGG - Intergenic
1057554357 9:96075796-96075818 TTATTTAAACAAGAGGAGGAGGG + Intergenic
1058312381 9:103519875-103519897 TGACATAACTATGAGGAGGAGGG - Intergenic
1058352865 9:104047137-104047159 TGCAATAAACATGAGGATGTAGG - Intergenic
1058642505 9:107101028-107101050 TGAAGAGAACATGAGGTGGCAGG + Intergenic
1059689525 9:116671549-116671571 GGTAGTAAATATGAGGAGGGGGG - Intronic
1059770163 9:117416189-117416211 TAAAGTCAAGATGAGAAGGAAGG - Intergenic
1060040377 9:120295374-120295396 TGAAGCCAACATGAGTTGGAGGG + Intergenic
1060254263 9:122013443-122013465 TGCAGTGAAGAAGAGGAGGAAGG + Intronic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1061596942 9:131636927-131636949 TGAAGGGAACATGGGGAGGCTGG + Intronic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1203587086 Un_KI270747v1:14159-14181 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1185971010 X:4663714-4663736 TAAACCAAACATGAGCAGGAGGG + Intergenic
1186937579 X:14467409-14467431 AGACCTCAACATGAGGAGGAAGG + Intergenic
1187364066 X:18652054-18652076 TGAAGTATGCCTGAGGAGGAGGG - Intronic
1187550662 X:20301569-20301591 TGAAGTTTTCTTGAGGAGGAAGG + Intergenic
1188026552 X:25216286-25216308 GGAAGAAAACAGGAGAAGGAAGG - Intergenic
1188122757 X:26329556-26329578 TGAAGAAAACATGTGGAGCAGGG + Intergenic
1188932498 X:36129780-36129802 TGAAATAAAAATGAGGAAAAAGG + Intronic
1190414977 X:50172176-50172198 TCAAGCAAATATGTGGAGGAAGG - Intergenic
1190795535 X:53737730-53737752 TGAAATCACCATGAGGAGGGAGG + Intergenic
1191219240 X:57969158-57969180 TGCAATAAACATGAGGATGCAGG + Intergenic
1191671891 X:63755497-63755519 AGAAGAAAAGACGAGGAGGAAGG + Intronic
1192589405 X:72347350-72347372 GGAAGTAAGGAGGAGGAGGAGGG - Intronic
1194687794 X:96945774-96945796 TGGATTAAACATGATGATGAGGG - Intronic
1195175676 X:102313165-102313187 TGAAGTAGACATGGCAAGGAAGG - Intronic
1195183188 X:102373928-102373950 TGAAGTAGACATGGCAAGGAAGG + Intronic
1195674582 X:107498244-107498266 TGAAGGAAACATGACAGGGAAGG + Intergenic
1195924430 X:110011606-110011628 TCAAGTAGACAGGAAGAGGATGG + Intronic
1196793518 X:119484724-119484746 TGCAATAAACATGGGGAGGCAGG + Intergenic
1199456367 X:148033828-148033850 TTAAGTAGAGAGGAGGAGGATGG + Intergenic
1199506950 X:148573600-148573622 AGAAAAAAACATGTGGAGGAAGG + Intronic
1201195071 Y:11485296-11485318 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic