ID: 1169817585

View in Genome Browser
Species Human (GRCh38)
Location 20:9674133-9674155
Sequence CAGCAGAAACAGAATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 1, 2: 3, 3: 84, 4: 735}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169817581_1169817585 -1 Left 1169817581 20:9674111-9674133 CCCCAAAAGCCAGGAAGTCTAGC 0: 1
1: 0
2: 1
3: 10
4: 252
Right 1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG 0: 1
1: 1
2: 3
3: 84
4: 735
1169817582_1169817585 -2 Left 1169817582 20:9674112-9674134 CCCAAAAGCCAGGAAGTCTAGCA 0: 1
1: 0
2: 2
3: 10
4: 155
Right 1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG 0: 1
1: 1
2: 3
3: 84
4: 735
1169817583_1169817585 -3 Left 1169817583 20:9674113-9674135 CCAAAAGCCAGGAAGTCTAGCAG 0: 1
1: 0
2: 2
3: 18
4: 221
Right 1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG 0: 1
1: 1
2: 3
3: 84
4: 735
1169817584_1169817585 -10 Left 1169817584 20:9674120-9674142 CCAGGAAGTCTAGCAGCAGAAAC 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG 0: 1
1: 1
2: 3
3: 84
4: 735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169817585 Original CRISPR CAGCAGAAACAGAATGAGAA TGG Intronic
901158549 1:7156916-7156938 CAGCAGAAACTGTAAGAGACGGG + Intronic
901164327 1:7206958-7206980 CAGCAGCCACTGAATGAGAGAGG - Intronic
901316290 1:8311780-8311802 AAGCAGAAAGAGAGTGAGACAGG - Intergenic
902113182 1:14099959-14099981 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
902680284 1:18038931-18038953 CAGCAGAAACACAATGACCTTGG + Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
904597053 1:31653529-31653551 TAGAAGAAACAGAAAGAAAAGGG + Intronic
905357639 1:37395877-37395899 CTTCAGAAACAAAATGTGAAAGG + Intergenic
905479103 1:38248973-38248995 AAGCAGAAACAGAAACAAAATGG - Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906848221 1:49218044-49218066 GAGCAGAAACAGAATCAGTAGGG - Intronic
907087978 1:51695608-51695630 CAGCGAAAACAGAATGGGATGGG + Intronic
907279538 1:53337537-53337559 CAGCAGAAACTGGAAGACAATGG - Intergenic
907464614 1:54626791-54626813 CAGCAGTTCCAAAATGAGAATGG - Intronic
907772356 1:57478212-57478234 CAGTAGTTACAGAATTAGAAAGG + Intronic
907972575 1:59398014-59398036 CTGGAGAAACAAAATTAGAAGGG - Intronic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908679226 1:66641079-66641101 CAGCAGGGATAGAAAGAGAAAGG + Intronic
908707782 1:66978708-66978730 CAGCAGTAACAACATAAGAATGG + Intronic
908902775 1:68975343-68975365 GAGCTGAAACATAATGAGACAGG + Intergenic
909252649 1:73378847-73378869 AAGCAGAAACAGAATAAAAAGGG + Intergenic
909375047 1:74930863-74930885 CAACAAAAACAGAAAGAAAAAGG + Intergenic
909553119 1:76921827-76921849 CAGCAAACTAAGAATGAGAAGGG + Intronic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
910903479 1:92148258-92148280 CGGCAGAAACATTATGAGCAAGG - Intergenic
911509237 1:98791149-98791171 CAGCAGAAAGAGGAGGAGAGGGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912581333 1:110723866-110723888 CAGAAGAAAGACAGTGAGAAAGG - Intergenic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
913630972 1:120709549-120709571 CAGAAGGAACATAAGGAGAATGG + Intergenic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915716552 1:157950115-157950137 CATCAAAAAAAGAAAGAGAAGGG + Intergenic
915746307 1:158161722-158161744 CAGCAGAGCTAGAAAGAGAAAGG + Intergenic
915916254 1:159942643-159942665 AAGCAGTTACAGAATTAGAATGG + Intronic
916287900 1:163131229-163131251 CAGGAGAAAGAGAGAGAGAAGGG - Intronic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
917710855 1:177682682-177682704 AAGCAAAATGAGAATGAGAAAGG - Intergenic
918400866 1:184161688-184161710 CAAAAGAAACACAATGTGAATGG + Intergenic
918485306 1:185022466-185022488 CAAGAGAGACAGAATGAAAAGGG + Intergenic
918497145 1:185153560-185153582 GAGTAGAAACAGAATTGGAAGGG + Intronic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
918797552 1:188922186-188922208 CAGTAGAAACAGAGTGTAAAAGG - Intergenic
919123344 1:193367866-193367888 CAAGAGAACCAGAATTAGAAGGG - Intergenic
919151257 1:193702139-193702161 CAGCAGTAAAAGAATCAGCAGGG - Intergenic
919247689 1:195009968-195009990 CAGCACAATCAAAATGATAAGGG - Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
920534756 1:206730209-206730231 CAGCAGAACCAGCACCAGAAGGG - Intronic
920793120 1:209111559-209111581 CTGCACAAACAGACTGAGACAGG + Intergenic
920937752 1:210451421-210451443 CAGAACAAACTGAACGAGAAAGG + Intronic
922325799 1:224527085-224527107 CAGCCGAAACAGACTAAGACAGG + Intronic
923367867 1:233280827-233280849 CAGAAGAAACAGATTTACAAAGG - Intronic
924021038 1:239783144-239783166 CAGCAGACAGAAAATCAGAAAGG - Intronic
924129034 1:240886593-240886615 AAGAAGAAAAAGAAAGAGAAAGG - Intronic
924391839 1:243569196-243569218 CTGCAGAAACTGAATGACCATGG + Intronic
1064825631 10:19396039-19396061 GAGTAGAAACAGAAATAGAATGG - Intronic
1065038593 10:21666064-21666086 CAGCAGACAGAGAAAGAGAAGGG - Intronic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1065447665 10:25819993-25820015 CAGCAAAAGCAGAATTAGAGTGG - Intergenic
1065670485 10:28111126-28111148 AAGCACAAAGAAAATGAGAAAGG + Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067277651 10:44849403-44849425 CAGCAGAGAGTGAATGAGCAAGG - Intergenic
1067347606 10:45447828-45447850 CAGCACAAACAGAGTAAGACAGG - Intergenic
1068299313 10:55118192-55118214 CAGTAAAACCAGACTGAGAAAGG + Intronic
1068732199 10:60371869-60371891 AAGCAGAAACATAAATAGAAGGG + Intronic
1068766772 10:60773225-60773247 CAGCAGGAACAAACTTAGAAAGG - Intergenic
1070043695 10:72808776-72808798 CAGGAGAGAGAGAATGTGAAGGG + Intronic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1070505255 10:77107227-77107249 CATTTGAAACAGAACGAGAAGGG + Intronic
1070572466 10:77650488-77650510 GAGAAGAAAAAGAAAGAGAAGGG + Intergenic
1070574212 10:77665279-77665301 CAGAGGAAACAGGGTGAGAAAGG + Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070664852 10:78335899-78335921 CAGCAGAAACAGCAAAACAAAGG + Intergenic
1070690719 10:78522829-78522851 CAGCAGAAGCACAATTACAAAGG - Intergenic
1072422039 10:95297333-95297355 CAGCAGGGACAGAATGAACAAGG + Intergenic
1072783053 10:98262978-98263000 CAGCAGGAACAGAAAGAGGGTGG + Exonic
1073125854 10:101148719-101148741 CAAAAGAAACAGAATGGAAAAGG - Intergenic
1073741918 10:106417076-106417098 CAGGAGAGACAGAGTGTGAAGGG + Intergenic
1073856115 10:107675147-107675169 TATCAGAAACAGAATTAAAATGG + Intergenic
1074144664 10:110706460-110706482 TATCAGAAAGAGAATGAAAAGGG - Intronic
1074646275 10:115456840-115456862 AAGCTGAAACAGTATGAGATTGG - Intronic
1074695452 10:116046346-116046368 CAGCAGATATAAAATGTGAATGG + Intergenic
1074897768 10:117791900-117791922 CAGCTGACCCAGAATAAGAAAGG + Intergenic
1075176727 10:120170972-120170994 CAACAGTAACACAAAGAGAAGGG - Intergenic
1075221230 10:120586582-120586604 CAGGAGGACCAGAATGGGAAAGG + Intronic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1076023431 10:127092817-127092839 GGTCAGAAACAGAATGAAAATGG + Intronic
1076297746 10:129400323-129400345 CAGCAGAAGGTGAATGACAATGG - Intergenic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1077734220 11:4771467-4771489 CAGGAGACAGCGAATGAGAAGGG + Intronic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1078277494 11:9864060-9864082 TAGCAGGAGCAGAAAGAGAATGG + Intronic
1078412732 11:11140789-11140811 CAGCAGAAATAGAATGTAGAGGG - Intergenic
1078778296 11:14413544-14413566 GAGCCCAAACAGAATGGGAAAGG - Intergenic
1078809167 11:14740982-14741004 CTGCAGAAAATGAATAAGAATGG - Intronic
1079110717 11:17603611-17603633 CAGGAGAAGCAGTATGGGAAGGG - Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080507671 11:32933055-32933077 CAGAAGAATAAGAAAGAGAAGGG - Exonic
1080659837 11:34286709-34286731 GAGCAGAAACAGCATGAAAATGG - Intronic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1081515943 11:43829738-43829760 CACCAGAAACAGAATAAGGAAGG - Intronic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1082189261 11:49223001-49223023 CAGCAGAGAGAGACAGAGAAAGG - Intergenic
1082820009 11:57538348-57538370 CAGAAGAAACAGGAAGAGAGAGG + Intergenic
1083450510 11:62741458-62741480 AAACAGAAACAGAATAACAAAGG - Intergenic
1083471204 11:62885267-62885289 CAGTAGAACCAGAATCAGACAGG - Exonic
1083487130 11:62990284-62990306 AAGAGGAAAGAGAATGAGAAGGG - Intronic
1083893345 11:65607833-65607855 CAGCGGGGACAGAATAAGAAGGG + Intronic
1086586014 11:88452043-88452065 CAGCAGAAGCAAAATAAGCATGG - Intergenic
1086597928 11:88596251-88596273 GGGAAGAAACAGAATGAAAAGGG - Intronic
1086677262 11:89623605-89623627 CAGCAGAGAGAGACAGAGAAAGG + Intergenic
1086738903 11:90342156-90342178 CAGCAGAAACAGAATTCTCAGGG - Intergenic
1086746915 11:90440396-90440418 CAGCACCAACTGAATGTGAATGG + Intergenic
1086895994 11:92313474-92313496 AAGCAGAAACATAATAAAAATGG - Intergenic
1087240855 11:95776587-95776609 CAACTAACACAGAATGAGAAAGG + Intronic
1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG + Intergenic
1087982580 11:104634361-104634383 TAGAAGGAAAAGAATGAGAAAGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089028695 11:115299487-115299509 CAGCTGAAAATGCATGAGAATGG + Intronic
1089112365 11:116066979-116067001 CCGCAGAACAGGAATGAGAAGGG + Intergenic
1090057100 11:123432718-123432740 CAGCAGGAAAAGAATGAGGTTGG + Intronic
1090167120 11:124561349-124561371 CACCAGAGACAGCAAGAGAAAGG - Intergenic
1090488310 11:127134987-127135009 AAGCAGAAATAGAATACGAATGG + Intergenic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1090827618 11:130398847-130398869 TAACAGAAACAGAAGGAGAAAGG + Intergenic
1090861068 11:130652850-130652872 CAGCAGTAAATGAATGAGCATGG + Intergenic
1090864650 11:130688602-130688624 AAACAGAAAAAGAAAGAGAAAGG + Intronic
1090998137 11:131885549-131885571 CAGCAGAAACTGCAAGAGCAAGG + Intronic
1091169409 11:133507033-133507055 CAGCAGTCACAGGATGAAAATGG - Intronic
1091436365 12:476201-476223 CAACAAAAACACAATGAGACAGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091536791 12:1417980-1418002 CAGCAGTAAAATAATGAAAATGG - Intronic
1091750924 12:3020812-3020834 AAGCAGAAACAGAGGGAGAGGGG - Intronic
1091910601 12:4227378-4227400 TAACAGATAAAGAATGAGAAAGG - Intergenic
1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG + Intronic
1092604024 12:10099687-10099709 CAGCACAAACAGACTAAGATGGG - Intronic
1092668645 12:10836619-10836641 CAGCAGAAACTGAGAGATAAGGG + Intronic
1092912794 12:13162979-13163001 CAGTAGAAATAAAATGAGTAAGG + Intergenic
1093044697 12:14429354-14429376 CACAAGAAATAGAATGAGAAAGG - Intronic
1093148305 12:15592212-15592234 CAGCAGAATTTGAATGTGAATGG - Intronic
1093741085 12:22690045-22690067 CAGAAGAAAAAGAATGAAATTGG + Exonic
1093784577 12:23177313-23177335 CAGGAGATACAGAATCAGCAGGG - Intergenic
1094451449 12:30586819-30586841 CACTGGAAACAGAATGAGAATGG - Intergenic
1094484496 12:30913812-30913834 CAGAAGAAAAAGAGTGAGATGGG + Intergenic
1094719509 12:33049019-33049041 CAGGAGGAAAAGAAAGAGAAAGG - Intergenic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097405323 12:59182321-59182343 CACCAGAAAGGGAAAGAGAAAGG - Intergenic
1097508072 12:60501409-60501431 CATGAGAAACAGAATGAATATGG + Intergenic
1098050699 12:66449474-66449496 CAGCTGAGATGGAATGAGAATGG - Intronic
1098177853 12:67811702-67811724 CAGGAGAAAGACAATGAGAATGG + Intergenic
1099286101 12:80715977-80715999 GAGCAGAAAGAGAGGGAGAAAGG + Intergenic
1099988200 12:89693942-89693964 AAGCAGAAATAGAAGAAGAATGG - Intronic
1100029665 12:90170705-90170727 TAGCAAATGCAGAATGAGAAAGG + Intergenic
1100093054 12:90995452-90995474 CAGAAGAAGCAGAAAAAGAATGG + Intronic
1100379264 12:94046523-94046545 CAGCAGAAACGAACTGAGACAGG - Intergenic
1100501977 12:95183160-95183182 CAGCAGAAGCATAGTGGGAAGGG - Intronic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101255248 12:102970936-102970958 CAGCACAAACGGAAAGAGACTGG - Intergenic
1101787787 12:107900836-107900858 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
1101898618 12:108774433-108774455 CAAAAGAAAAAGAAAGAGAAAGG + Intergenic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1104034135 12:125086931-125086953 CAGCAGAAACGGCCTGTGAAAGG + Intronic
1104168299 12:126255265-126255287 CAACAGAAAAAGAGTGAGATGGG + Intergenic
1104795029 12:131511331-131511353 CAGGAGACACAGACTCAGAAAGG + Intergenic
1104831506 12:131755361-131755383 GAGCAGAAAAAGAAAGAAAATGG - Intronic
1105652135 13:22390622-22390644 CAGCATAAAGAGAATGAAAAGGG - Intergenic
1105904298 13:24790556-24790578 CAGCACAAATAGAATAAGACAGG - Intronic
1105923371 13:24985071-24985093 CAGAAGATACAGCAGGAGAAGGG + Intergenic
1105984359 13:25550645-25550667 AAGGAGAAACGGAAGGAGAATGG - Intronic
1106038720 13:26069414-26069436 CAGCAGGATCAGAATCAGAGAGG - Intergenic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107485987 13:40827995-40828017 CATCAGAAACAAAAGTAGAATGG + Intergenic
1107532458 13:41297125-41297147 AAGCAGAAAAAGAATTACAAGGG + Intergenic
1108036596 13:46296643-46296665 CAGGAGAGAAAGAATCAGAAAGG - Intergenic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108727582 13:53200039-53200061 CAGCAGCCACAGAATCAGCAAGG - Intergenic
1108835962 13:54549243-54549265 CAACTAAAACAGTATGAGAAAGG + Intergenic
1109004557 13:56855340-56855362 CAGAAAAAAAAGAATGTGAAAGG + Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109415124 13:62028847-62028869 CGGCAGAAATGGAATGAGAATGG + Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109611875 13:64775933-64775955 CATCAGAAACATACAGAGAAGGG + Intergenic
1109875619 13:68400176-68400198 CAGCAGAAAAAGAAGGGCAAAGG - Intergenic
1110574199 13:77037369-77037391 CAGGAGAAACAGACTGAGTGGGG - Intergenic
1110748734 13:79087624-79087646 CAGGTGAAATAGATTGAGAAAGG + Intergenic
1110819329 13:79896376-79896398 CAGGAGAAAGAGAGTGAGAGGGG + Intergenic
1110870853 13:80451230-80451252 CAACAGAAAAAAATTGAGAAAGG - Intergenic
1111508964 13:89235267-89235289 CAGCAAAGAGAGAATGAGAGAGG - Intergenic
1111643649 13:91002592-91002614 CAGGAACAACAGAAAGAGAAAGG - Intergenic
1111683353 13:91470914-91470936 CAATAAAATCAGAATGAGAAAGG - Intronic
1111790661 13:92851084-92851106 GAGCAGCAAGAGAAAGAGAAGGG + Intronic
1112119065 13:96389806-96389828 TAACAGAAACAGAATCAAAATGG + Intronic
1112428789 13:99331225-99331247 CAGAAGAAAAAAAATAAGAAAGG - Intronic
1112463003 13:99619451-99619473 CAGCATAAACAGACTAAGACAGG + Intronic
1113222108 13:108116805-108116827 CTGCAGAAACAAAAACAGAATGG + Intergenic
1113728346 13:112622466-112622488 CAGCAGACACAGAAAGGAAAGGG - Intergenic
1113935556 13:113993170-113993192 AAGCAGACATAGAATGAGCAGGG - Intronic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1114863841 14:26562517-26562539 AAGCAGAAAGACAAGGAGAAGGG + Intronic
1115024764 14:28730348-28730370 TAGCAGAAACAGGATGACGAAGG - Intergenic
1115841666 14:37478346-37478368 TTGCAGAAACAGAAAAAGAATGG + Intronic
1116474913 14:45328631-45328653 CAGCAGGATAAGAATGAGCAAGG + Intergenic
1117249162 14:53918206-53918228 CAGCACAAACAGATTAAGACAGG - Intergenic
1118433178 14:65742879-65742901 CAACAGATTCAGAATGAGAATGG + Exonic
1119464403 14:74843683-74843705 CAGCAGAAGCAGAATAAAACAGG + Intronic
1119667543 14:76496154-76496176 CAACAGAAACACAATGAGCTAGG - Intronic
1119688720 14:76653937-76653959 CAGCAGCAACAGAATGGTAGGGG + Intergenic
1120441719 14:84549431-84549453 CACCAGAAACTGAAAGAGGAAGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1121170800 14:91852733-91852755 CAAGAGAAAGAGAAAGAGAAGGG + Intronic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121861668 14:97324427-97324449 CAGCAGAAACAGGAAGGCAATGG - Intergenic
1121941746 14:98077340-98077362 CAGCAGAGAAGGAATGAGATGGG - Intergenic
1123172201 14:106384743-106384765 CAGCACAAAGATAATAAGAAAGG - Intergenic
1202895485 14_GL000194v1_random:5265-5287 CTGCAGAGACAGAATTAAAAGGG + Intergenic
1123883466 15:24697934-24697956 CAGCAGACACAAAATCAGTAAGG - Intergenic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1124864327 15:33474094-33474116 AAGCAGAAACAGCCTGAAAATGG - Intronic
1125063885 15:35458611-35458633 CAGCAGAGAAAAAAAGAGAATGG + Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125626341 15:41112425-41112447 TAGCATATAGAGAATGAGAAGGG - Intronic
1126059784 15:44769328-44769350 CAGCATAAAAAGAAAAAGAAAGG + Intergenic
1126519447 15:49574697-49574719 CAGAAGATCCAGAATTAGAAAGG - Intronic
1126525429 15:49648996-49649018 TAGGAGTAACAGAATGGGAAAGG + Exonic
1126532096 15:49721788-49721810 GAGAAGGAACAGTATGAGAAGGG - Intergenic
1126589574 15:50325403-50325425 CAGCAGAAACAGAACCAGACAGG - Intronic
1126689720 15:51279970-51279992 AAGGAGAAACAGAGAGAGAAGGG + Intronic
1127332486 15:57952552-57952574 CATCAGGAAAAAAATGAGAAAGG - Intergenic
1127601937 15:60546485-60546507 CAGGAGAAACAGATAGAGACAGG + Intronic
1127751982 15:62055114-62055136 GAACAGAAACAGAAAGACAATGG + Intronic
1128033466 15:64502080-64502102 CAGCAGAATGAGAAAGAAAAGGG + Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128423077 15:67513170-67513192 TAGCAGAGAAAGAATGAGATGGG + Intergenic
1128705752 15:69836549-69836571 CAGTGGAAACAGAAACAGAAAGG - Intergenic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1130267389 15:82419672-82419694 CAAAAAAAACAGAATGAAAAAGG + Intergenic
1130726054 15:86440746-86440768 CAGCACAAACACAATAGGAATGG + Intronic
1130982734 15:88823858-88823880 TAGCAGAAAAGGAGTGAGAATGG + Intronic
1131651350 15:94403181-94403203 CAGCAGAAAAAGTATAGGAAAGG - Intronic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1131674125 15:94653986-94654008 CAGCACAAACTGAATAAAAAAGG - Intergenic
1131816450 15:96226063-96226085 CAGCACAAACACAATGCCAAAGG + Intergenic
1131938910 15:97539156-97539178 CATCAAAAAAAGAATGAGCATGG + Intergenic
1132020180 15:98354212-98354234 CCGAAGAAACTGAAAGAGAATGG + Intergenic
1132038023 15:98502605-98502627 CAGCAGAAAGAGAAAGGAAAGGG + Intronic
1132137810 15:99360698-99360720 CACAAGAAATAGAATGAGATTGG + Intronic
1133958092 16:10464801-10464823 CAGCAACAAAAGAATGAGTAGGG - Intronic
1134572853 16:15306454-15306476 CAGCAAAAACAGACTAAGACAGG + Intergenic
1134729533 16:16449582-16449604 CAGCAAAAACAGACTAAGACAGG - Intergenic
1134798416 16:17062516-17062538 CAGCAGAAACACAAAGAGAATGG - Intergenic
1134937904 16:18262324-18262346 CAGCAAAAACAGACTAAGACAGG + Intergenic
1135156112 16:20054218-20054240 CAGCACAAACAGAATGACTTTGG - Intronic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1136301095 16:29334847-29334869 CAGCAGAAAGAGCGTGAGACGGG - Intergenic
1136670177 16:31849519-31849541 CAGCAGACAGAGAAAGAGAAGGG + Intergenic
1137328179 16:47461935-47461957 TAGCAGAAACTGAAGGAGACTGG + Intronic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137782474 16:51109253-51109275 ACTCAGAAACAGAATGAGAGGGG - Intergenic
1138090400 16:54169137-54169159 CTGCAGAAAGAAAATGAAAATGG - Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139114716 16:63936107-63936129 AAGCAGAAATACAATGAGTATGG - Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139417146 16:66822112-66822134 CAGCAGAACCAGGCTGAGACAGG - Intronic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139563636 16:67759248-67759270 GAGAAACAACAGAATGAGAAAGG + Intronic
1139715859 16:68812628-68812650 TACCAGAAACACCATGAGAATGG - Intronic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142683986 17:1566723-1566745 CAGGAGAAACAGGAAGAGAGAGG - Intergenic
1142955488 17:3518687-3518709 GAGCAGGAACAGAAAGAGAATGG + Exonic
1143000476 17:3791722-3791744 CAGCAGATAATGAATCAGAATGG + Intronic
1143830798 17:9648836-9648858 AAAGAGAAACAGAAAGAGAAAGG - Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1145883970 17:28370165-28370187 CAGCAGGGCCAGTATGAGAAGGG + Exonic
1146284040 17:31562375-31562397 CAGCAGGATCGGAATGACAAAGG + Intergenic
1146684401 17:34831249-34831271 CAGAAGATCCAGAAAGAGAATGG + Intergenic
1146849889 17:36212782-36212804 CAGCAGAGAAAGAGTGAGAGTGG - Exonic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1149039321 17:52169220-52169242 GAGCAGAAAGAGAAGGGGAAGGG - Intergenic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1149773390 17:59339038-59339060 AAGCAAAAACAGAAAGAGCAAGG - Intronic
1150333862 17:64316019-64316041 AAGCAGAGAAAGAATGAGAGAGG + Intergenic
1151232380 17:72694183-72694205 CAGCAGAGCCAGCATGAGAGAGG - Intronic
1151510370 17:74555263-74555285 CTCAGGAAACAGAATGAGAAGGG - Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153480392 18:5542650-5542672 CAGAACAAATAGAATGATAAAGG - Intronic
1153718624 18:7878153-7878175 TAGCAGAAATACAATTAGAATGG - Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155426435 18:25712303-25712325 CAGCACAAAAAGAATGACAATGG + Intergenic
1155834901 18:30568828-30568850 CAGCAAAAAAAGAATGGGAGTGG + Intergenic
1155917327 18:31569542-31569564 GAGCAGATAGAAAATGAGAATGG + Intergenic
1155942318 18:31811568-31811590 CAGCAGAAACAGCACTAAAATGG + Intergenic
1156151313 18:34246754-34246776 CAGCAGCAACAGTATGGGGAGGG + Intergenic
1156661997 18:39357267-39357289 GAGCATAAACAGAATGGCAAAGG - Intergenic
1156767888 18:40680863-40680885 CACCAGAAAGTGAATGAGATAGG - Intergenic
1156865128 18:41880513-41880535 CAGGAACAAAAGAATGAGAAAGG - Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157980951 18:52379867-52379889 CAGCACAAACAGATTAAGACAGG - Intronic
1158246886 18:55442382-55442404 GATCAGAAAAAGAATGAAAAGGG + Intronic
1159013111 18:63077528-63077550 CAGCAGAAACAAAATCATAAGGG - Intergenic
1159240079 18:65730872-65730894 CAGCAGATACAAAATAAAAAAGG + Intergenic
1159351214 18:67275573-67275595 CAGCAAATAAAGAATGAAAAAGG - Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1161642435 19:5432729-5432751 CACCAGAATCAGAATCAGAAAGG + Intergenic
1161661156 19:5547088-5547110 CAGCGGCAACAGATTGTGAAGGG + Intergenic
1161671569 19:5614489-5614511 CAGCAGTACCAGACTGAGAAAGG + Intronic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1162761292 19:12890051-12890073 CAACAGATACACAATCAGAATGG + Intergenic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164482416 19:28622701-28622723 GAGCAAAAACAGAAAGAGAAGGG + Intergenic
1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG + Intergenic
1164728100 19:30480365-30480387 CAAAACAAACAGACTGAGAAAGG - Intronic
1166195949 19:41206087-41206109 CAGCAGATACCTAAGGAGAAGGG - Exonic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167783877 19:51620303-51620325 CAGAAGAAACAGGAGGAAAAAGG + Intronic
1168691442 19:58380018-58380040 CAACAAAAACAGAATGTGCAGGG + Intronic
925165371 2:1712661-1712683 CAGCAGAACTAAAATGAAAACGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925322875 2:2990399-2990421 AGGCAGTAACAGAATGGGAAGGG + Intergenic
925498813 2:4482068-4482090 CAGCACAGCCAGAATAAGAAAGG + Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926198411 2:10777094-10777116 TTGCAGAGACAGAATGGGAAAGG + Intronic
926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG + Intergenic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
926947839 2:18207602-18207624 AAGCAGAAAGAGAAAGTGAAAGG - Intronic
927617303 2:24612237-24612259 CAGCAGAAACTGTATAAGATTGG - Intronic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
928688474 2:33775007-33775029 GAGGAGAAACAGAATGCAAAAGG - Intergenic
928736168 2:34292101-34292123 CAGAAGAAAAGAAATGAGAATGG + Intergenic
928765690 2:34642501-34642523 AAACAGAAACAGAAAGAGAAAGG + Intergenic
929353261 2:40987168-40987190 CAGAAGAATCTAAATGAGAAAGG - Intergenic
929433854 2:41911684-41911706 CAGCAGACACAGAATAGCAATGG - Intergenic
929483349 2:42333831-42333853 CAGCAGCCACAGAAACAGAATGG + Intronic
930559318 2:52940637-52940659 TGGTAGAAACAGAATGATAATGG - Intergenic
931903274 2:66815081-66815103 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
932315738 2:70780934-70780956 CAGCCCAATCAGGATGAGAACGG + Intronic
932378120 2:71256187-71256209 GAGAAGATACAGAATGAGAAGGG + Intergenic
932840830 2:75080949-75080971 TAGAAAAGACAGAATGAGAATGG + Intronic
933453895 2:82497375-82497397 GATTAGAAACATAATGAGAAGGG - Intergenic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
934064220 2:88325052-88325074 AAGCAGAATCAACATGAGAAAGG + Intergenic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934538568 2:95157004-95157026 CACCAGTAACAGGATGTGAATGG - Intronic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
934884342 2:98011503-98011525 AAGAAGAAAAAGAAAGAGAAAGG - Intergenic
935227582 2:101067040-101067062 CACCAGAAACAGCAGGAGAGAGG - Intronic
935234171 2:101124186-101124208 CACCAGAAACAGCAGGAGAGAGG + Intronic
935356841 2:102209332-102209354 GAGCAGGAAAAGAATAAGAAGGG + Intronic
935794724 2:106630100-106630122 CAGCAGAAACAGCATGAAGAAGG - Intergenic
936391441 2:112078186-112078208 CAGCACAAACAGACTAAGATAGG - Intronic
936703705 2:115044301-115044323 AAGGAGAAACAGAGAGAGAAGGG + Intronic
936895842 2:117426644-117426666 CAACAGAAACAAAAATAGAAAGG - Intergenic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937244788 2:120485656-120485678 CACCAGGAAAAGAATGAGCAGGG - Intergenic
937884464 2:126890376-126890398 CAGCAGAGACAGAAACAGCAGGG - Intergenic
937962424 2:127470377-127470399 CAGCAAAACCTGAAAGAGAATGG + Intronic
938703505 2:133899858-133899880 CCGGAGAAACAGAATGTGAGTGG - Intergenic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
939575567 2:143891014-143891036 AAGCAGACACAGAACCAGAATGG - Intergenic
940196013 2:151094845-151094867 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
940251819 2:151686259-151686281 CTGCAGACACAGAATATGAATGG - Intronic
940664847 2:156596021-156596043 AGGCAAAAACACAATGAGAAAGG - Intronic
940996781 2:160158346-160158368 CAGCAGTAACAGAGTGATAAGGG + Intronic
941256187 2:163234252-163234274 CAAGAGAGACAGAAAGAGAAGGG + Intergenic
941553893 2:166951387-166951409 CAGGAGAAACAGAGAGATAAAGG + Intronic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941886305 2:170531072-170531094 CAGCAGACACAGATCCAGAAAGG - Intronic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
942336494 2:174892568-174892590 CAGCACAAACAGACTAAGACAGG + Intronic
942471499 2:176265420-176265442 CAGGAGGAAGAGAAAGAGAAGGG - Intergenic
942659720 2:178251481-178251503 GAGCAGAAATAAAATGACAAGGG + Intronic
942791356 2:179765114-179765136 AAGCAGAACCAGTAGGAGAAAGG - Intronic
942909606 2:181227180-181227202 GAGAAGAATCAGAACGAGAAGGG + Intergenic
943869250 2:192972969-192972991 TAGAAGAAACACCATGAGAAAGG - Intergenic
943964466 2:194315035-194315057 CAAAAGAAACAGAATGAAAAGGG - Intergenic
944454085 2:199875671-199875693 GAGCAGAAACATAAAGACAATGG - Intergenic
945239433 2:207662586-207662608 CAGCAGAAACAGACTAAGATGGG + Intergenic
945584431 2:211640950-211640972 CAGCAGACAGACAATTAGAAGGG + Intronic
945680066 2:212903186-212903208 CAGCAGAAAGGGTATGAGTAGGG - Intergenic
945752308 2:213803468-213803490 CAGAAGAGACAGAAAGACAATGG - Intronic
945990111 2:216388928-216388950 CAGCAGCAACAGCATGCTAATGG - Intergenic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946175142 2:217917971-217917993 CGGCTGAAACAGAATGAGTGAGG + Intronic
946414783 2:219534528-219534550 CAGCAGAAACAGAAGGTGAGAGG - Intronic
946869319 2:224071677-224071699 CAGCAGCCACAGCCTGAGAAGGG - Intergenic
946976398 2:225157123-225157145 TAGCACAAAAAGAAGGAGAAAGG + Intergenic
946978396 2:225178439-225178461 GTGAAGAAACGGAATGAGAAGGG - Intergenic
947215111 2:227743273-227743295 CAGCAGTGACAGCATGACAATGG - Intergenic
947219222 2:227777199-227777221 CAGCAGGAACAGACTAAGACAGG - Intergenic
947265882 2:228280456-228280478 CAGCAGTAACTGAAAGGGAATGG + Intergenic
947411742 2:229848531-229848553 TACCAGAAACAGAACGAAAAAGG + Intronic
947443037 2:230140038-230140060 CAGGAGAGAGAGAATGTGAAGGG - Intergenic
947900047 2:233713657-233713679 GAGCAGAAACAGCATGGCAAAGG - Exonic
948787747 2:240361764-240361786 CAGCAGAGACTGAAGGACAATGG + Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948952458 2:241263072-241263094 CAGCCGAAAGACAAGGAGAAAGG + Intronic
1169734343 20:8821894-8821916 CAGCAGAAACAGGAGAAGCATGG - Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170018201 20:11806745-11806767 CAGGAGGAAAAGAGTGAGAAGGG - Intergenic
1170369175 20:15629989-15630011 GGGAAGAAAAAGAATGAGAACGG - Intronic
1170393712 20:15903415-15903437 CAGCAGCAACAGAGAGTGAAGGG + Intronic
1170696121 20:18660545-18660567 AAGCAGAAACTGAAAGAAAAAGG + Intronic
1170930517 20:20766219-20766241 CAGCAGGAAGAGCATGAAAATGG - Intergenic
1171154505 20:22859778-22859800 CAGAAGAAACAGCATGTGCAAGG - Intergenic
1171194537 20:23186968-23186990 CAGCAGACACCCAGTGAGAAAGG - Intergenic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172451772 20:35030452-35030474 CAGCACAAAAAGAATGAAGATGG - Intronic
1172524236 20:35588311-35588333 CCGCAGAAACAAGATGACAAAGG + Intergenic
1172665887 20:36599610-36599632 CAGCAGAAAAAGGCTGAGCACGG + Intronic
1172950763 20:38722295-38722317 CACCAGAAACAGAAGGGGAGAGG + Intergenic
1173098266 20:40059370-40059392 CAGCAGCAAGAGAGAGAGAAAGG - Intergenic
1173327186 20:42044698-42044720 CAGAAGAAACCCAATGAGAGAGG + Intergenic
1173764609 20:45596083-45596105 CAACAGGGACAAAATGAGAAGGG - Intergenic
1174062350 20:47841737-47841759 CAGGTGAAAAAGAAAGAGAAGGG - Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175411275 20:58771093-58771115 CAAGAGAAAGAAAATGAGAAGGG + Intergenic
1175533386 20:59689960-59689982 CAGCAGAAACCCAATTAGATGGG - Intronic
1175545815 20:59777082-59777104 CACCAGAAACTGGAAGAGAATGG - Intronic
1175707613 20:61192693-61192715 CAGCAGAGAGAGAAAGAGACAGG - Intergenic
1176032561 20:63020617-63020639 CAACAGAAACAGACCCAGAAAGG - Intergenic
1176162831 20:63657205-63657227 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
1176886771 21:14265807-14265829 CAGGAGAAACAGAGAGAGAGCGG - Intergenic
1176911870 21:14575770-14575792 AAGCACAAAGAAAATGAGAATGG + Intronic
1176955305 21:15095782-15095804 CACCAGAAATAAAATGAGACTGG - Intergenic
1177671706 21:24239216-24239238 CACAAGAAGCTGAATGAGAATGG + Intergenic
1178425506 21:32476211-32476233 CAGCAGAAAAAGCATGTCAAGGG - Intronic
1178493248 21:33067665-33067687 CAGCAGAAAGAGGAAGTGAATGG - Intergenic
1180784024 22:18536975-18536997 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1180855394 22:19041874-19041896 CAGCAGTGACAGGATGAGGAAGG + Exonic
1180885287 22:19239177-19239199 CAGCAGAAGCAGACTAAAAATGG + Intronic
1180987471 22:19913299-19913321 CAGCTGAAGCTGAGTGAGAATGG + Intronic
1181127592 22:20711023-20711045 CAGCAGGCAGAGAAAGAGAAGGG + Intronic
1181240924 22:21476327-21476349 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182043829 22:27259126-27259148 AAGCAGCAACAGAGAGAGAAGGG - Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183601134 22:38841262-38841284 CAGCAGCCACAGACAGAGAAGGG - Intronic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
950120790 3:10481311-10481333 CCGCAGAAACAGAAAAAGAGAGG - Intronic
950277326 3:11673711-11673733 CAGCAGATACAAAATCAGAATGG + Intronic
950519345 3:13487323-13487345 CAGCACACACAGAATGACCAGGG - Intronic
950643667 3:14364407-14364429 TAGCAGAACTAGAATTAGAACGG - Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951164145 3:19464566-19464588 CAGCAGTAACAGAATAAAAAGGG + Intronic
951417271 3:22440132-22440154 CAGCTGGGACAGAAAGAGAATGG + Intergenic
951800519 3:26590631-26590653 CAGGAAAAAGAGAAAGAGAAGGG - Intergenic
951902233 3:27668156-27668178 CAGCAGGAACAGGAAGAGAAAGG + Intergenic
952585902 3:34891791-34891813 CATCATAAACATCATGAGAAAGG - Intergenic
952699917 3:36316600-36316622 CAACAGAAACAGACTGTGAGAGG - Intergenic
952873092 3:37919689-37919711 CAGCAGAGATGGAATGGGAAAGG + Intronic
953892109 3:46759005-46759027 AAGCAAATACAGAATGAAAAAGG + Intronic
954636783 3:52075175-52075197 GGGCCCAAACAGAATGAGAATGG - Intergenic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
955932377 3:64070404-64070426 GAGCAGACATAGAAAGAGAAAGG - Intergenic
955969916 3:64428416-64428438 CAAGAGAAATAGAATTAGAAGGG + Intronic
956609145 3:71104395-71104417 CAGCAGCAACAGCAGCAGAAGGG - Intronic
956856376 3:73279035-73279057 CAAAGGAAACAGGATGAGAATGG - Intergenic
956974425 3:74563831-74563853 CAGAAAACACACAATGAGAACGG - Intergenic
958150754 3:89691119-89691141 CAGCAGAAACAGCAAAAGAATGG - Intergenic
958445996 3:94215824-94215846 CAGCACAAACAGACTAAGACAGG - Intergenic
959296731 3:104544835-104544857 CAGGAAGAACAAAATGAGAAAGG - Intergenic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
959877579 3:111403194-111403216 CAGCAAAAGCAGAATTAAAAGGG - Intronic
960827267 3:121802673-121802695 CAGAAGAAAGAAAATGATAAAGG - Intronic
961370670 3:126427908-126427930 CAGCAGCAAGAGAATGGGAGTGG + Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
961945397 3:130681932-130681954 TGGCAGGAACAGACTGAGAATGG + Intronic
962132873 3:132701235-132701257 GAGAAGACACAGAATGAGAAAGG - Intronic
962137692 3:132754542-132754564 AAGCACAAACAGAATGACAGTGG + Intergenic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962988831 3:140560294-140560316 CAGCATAAAGAGAATGTCAATGG - Intronic
963155341 3:142090508-142090530 CAGAAGACAAAGAAAGAGAATGG - Intronic
963445033 3:145394716-145394738 TATCAGTAACAGAATAAGAAGGG + Intergenic
964261926 3:154849142-154849164 CAGCATTAACACAATGCGAAGGG + Intergenic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
964548606 3:157861935-157861957 GAGAAGACACATAATGAGAAAGG - Intergenic
965499439 3:169440469-169440491 CAGGAGAAACCCAATGAGCAAGG + Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966565499 3:181376263-181376285 TAGCAAAAGCAGACTGAGAAAGG + Intergenic
966778661 3:183564706-183564728 CAGCAGAAACAGGAGGCAAAAGG + Intergenic
967279307 3:187806658-187806680 CAGGACACACAGAATGAGAGTGG - Intergenic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
967936268 3:194730389-194730411 CAAAAGAAAAAGAATGAGAAAGG + Intergenic
968022249 3:195403232-195403254 CGGCCGAAACAGAACCAGAAAGG + Intronic
968675675 4:1877672-1877694 TGGCTGGAACAGAATGAGAATGG - Intronic
968870154 4:3237975-3237997 CAGCAAAAACATAATGGGAACGG + Intronic
969134118 4:5016332-5016354 CAGCAGAAACAGACTAAGACAGG + Intronic
969715376 4:8865796-8865818 CAGATGAAACCGAGTGAGAACGG + Intronic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970483166 4:16498263-16498285 CAGCAACAACAGAATTTGAAAGG + Intergenic
970758407 4:19453633-19453655 CAGGAGAGAGAGAGTGAGAAGGG - Intergenic
971408597 4:26346209-26346231 CAAAAGAAAGAGAAAGAGAAAGG + Intronic
971748912 4:30621023-30621045 TAGCAGAAACAGGATGCTAAGGG + Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
972393388 4:38634374-38634396 CAGAAGAAATAGAATGACAAAGG - Intergenic
972562727 4:40243158-40243180 CAACTGGAACAGAAAGAGAAGGG - Exonic
973164285 4:47057224-47057246 CAGCAGAGACACAATGAGAGAGG - Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
974377073 4:61092633-61092655 CATCAGAAAAAGACTGAAAATGG + Intergenic
974377906 4:61101631-61101653 CAGCAAAAATAGAGAGAGAAAGG + Intergenic
974385800 4:61201158-61201180 AAGAAGAAAAAGAAAGAGAAGGG + Intergenic
974454839 4:62115607-62115629 CCTCAGGAACAGAATTAGAATGG + Intergenic
974692764 4:65320458-65320480 TAGGAAAAACAAAATGAGAAAGG + Exonic
974733423 4:65898562-65898584 CAGGAGAAACAGAGTGAAAGGGG + Intergenic
974855144 4:67452426-67452448 CAGGAGAAAGAGAAAGTGAAGGG - Intergenic
974858897 4:67495939-67495961 CAGCAGAGATTGAAGGAGAAGGG - Intronic
975330938 4:73112043-73112065 CAGCACAAACAAAAAGAGGATGG + Intronic
975391066 4:73817970-73817992 GAGCAGAAAAGGAAAGAGAAGGG + Intergenic
975650195 4:76585386-76585408 CAGCACACACAGAAAGAAAATGG - Intronic
975665829 4:76733938-76733960 CAGCAAAAACAGAGTGTCAAGGG - Intronic
975892492 4:79046340-79046362 CAGCAGGCACAGAAGCAGAAGGG - Intergenic
976118447 4:81753898-81753920 CAGCACAAACAGACTAAGAAAGG - Intronic
976744398 4:88389081-88389103 GAGCAGAAACCAAATGAAAAGGG + Intronic
976881978 4:89937489-89937511 CAACAGAAACAGAGGGAGAGTGG + Intronic
977087905 4:92628306-92628328 CAGCAGTAAAAGATTAAGAAGGG + Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977778348 4:100950661-100950683 CAACAGAGACAGAAACAGAAAGG + Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979733054 4:124048037-124048059 GGGCAGAAAGAGAATGAAAATGG - Intergenic
979889951 4:126079045-126079067 CAGCAGAAACATATTAAAAATGG - Intergenic
979916245 4:126437654-126437676 AAGAAGAAACAGAGTGAAAAGGG - Intergenic
980728779 4:136800530-136800552 AAGCAAAAAAAGAATTAGAAAGG - Intergenic
980804369 4:137792870-137792892 CAGCAGCAAAAGAAAGAAAAGGG + Intergenic
981008841 4:139903724-139903746 CAGCACAAACAGACTAAGATTGG - Intronic
981062482 4:140439924-140439946 CAAGAGCAACAGAGTGAGAATGG - Intergenic
982080805 4:151787668-151787690 CACCAGGAACAGAATTAGCATGG - Intergenic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982396138 4:154918000-154918022 CAGCAAAAACAGCATCAGACTGG + Intergenic
982635505 4:157891405-157891427 AATCAGAAATAGAACGAGAATGG + Intergenic
982793202 4:159616183-159616205 TAGTAGCAACAGAATGAGAAGGG - Intergenic
982934760 4:161458641-161458663 AAGCAGAAACAGAAAGAAAATGG - Intronic
983380413 4:166984628-166984650 CAGCAGAAACTGAATAAACAGGG + Intronic
984199768 4:176703889-176703911 CATGAGAAACTGAATCAGAAAGG - Intronic
984250234 4:177323242-177323264 CAGAAAAGACAGAATGAGATTGG - Intronic
984483261 4:180333266-180333288 CAGGACATAGAGAATGAGAATGG + Intergenic
984492044 4:180446696-180446718 TGGCAGAAACAGAATAAAAATGG - Intergenic
984576229 4:181451621-181451643 CAGCTGGATCAGAAAGAGAATGG + Intergenic
984623389 4:181978290-181978312 TGGCAGAACCAGGATGAGAAGGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985345049 4:188995512-188995534 GAGCAGAAGCAGAAGGACAAAGG + Intergenic
985383418 4:189419941-189419963 CAGCAGAAAAAATATTAGAACGG - Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985832741 5:2247446-2247468 AAGAAGAAACAGGAGGAGAAGGG - Intergenic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
986162432 5:5242036-5242058 CAGCAGCTACAAAATAAGAAAGG - Exonic
986436656 5:7740120-7740142 TAGCCGAAATAAAATGAGAAAGG + Intronic
987092651 5:14521849-14521871 CAGCAGGGTCAGCATGAGAAAGG + Intronic
987240366 5:15992105-15992127 GAGGAGAAACAGAGAGAGAAAGG - Intergenic
988031530 5:25769730-25769752 CAGGAGAAAGAGAGTGAGTAGGG + Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988624719 5:32861426-32861448 AAGCACAATCAGAATGACAAAGG - Intergenic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989417634 5:41198891-41198913 GAGCAAAATCCGAATGAGAATGG - Intronic
989669987 5:43905532-43905554 TAGCAGACACAGGAGGAGAAAGG - Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
990064222 5:51692691-51692713 CAGCAGAAACAGACTAACACAGG - Intergenic
991325756 5:65430327-65430349 CTGCAAAAACAGAATTAGAGAGG + Intronic
992072048 5:73157269-73157291 CAACAGAAACAGAATGTGGCAGG + Intergenic
993390837 5:87318547-87318569 CAGGAGAAACAGCATGTGAAGGG + Intronic
993844173 5:92919724-92919746 CAGCAAAAAATGAAGGAGAAAGG - Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994653747 5:102562785-102562807 CAGCAGAAACAGATTAATAGAGG + Intergenic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
996497189 5:124172601-124172623 GAGTAGAAAGAGAAAGAGAATGG + Intergenic
997000727 5:129757266-129757288 AATCAGAAACAGACTGGGAAAGG + Intronic
997022239 5:130015168-130015190 CAGGAGAGACAGAAAGTGAAGGG - Intronic
997133332 5:131299057-131299079 CAACAGAAAGAAATTGAGAATGG + Intronic
997502677 5:134389285-134389307 TAGCAGGAAGAGAATGAGATAGG - Intronic
997853486 5:137353623-137353645 CAGCAGCTACAGAATTTGAATGG - Intronic
997879853 5:137579852-137579874 TAGCTGAAACAGAACAAGAACGG + Intronic
998367993 5:141643468-141643490 CAGCAGAAAGAGAATAGGAGTGG - Intronic
998987527 5:147777131-147777153 CAGCAGACAAAGAATGACCAAGG + Intronic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1000537132 5:162493126-162493148 CAGGAGAAATAGCATGGGAATGG + Intergenic
1000864958 5:166502116-166502138 CATCAGAAACAGAATGTTACTGG + Intergenic
1001847155 5:174932468-174932490 CAGCAAAAACAGACTAAGATGGG - Intergenic
1001902116 5:175441007-175441029 CAGCAGAAACTGATAGATAAGGG - Exonic
1002199836 5:177521509-177521531 CAGCTGAAGCAGTATAAGAAGGG - Intronic
1002940924 6:1715088-1715110 CAGCAGAAACATAAGGAGACAGG + Intronic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003450124 6:6223040-6223062 AGCCAGAAACAGAATGAGAGTGG - Intronic
1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG + Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003922006 6:10841205-10841227 CAAAAGAAAGAGAAAGAGAAAGG + Intronic
1004013531 6:11711656-11711678 CACCAGCAACTGCATGAGAAAGG + Intergenic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1004714611 6:18205136-18205158 CAGCAGGACCAGAAAGAGAATGG + Intronic
1004883836 6:20033356-20033378 CAGAAGAAACAAACTGCGAACGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005513975 6:26537320-26537342 CGGCAGAGACAGACCGAGAAAGG + Intergenic
1005814213 6:29537908-29537930 CAGCAGCAACAGAAGGTCAAAGG + Intergenic
1006003912 6:30987722-30987744 CAGCAGAAACACAAGGAAATGGG + Intronic
1008153011 6:47978109-47978131 GAGAAGAAAAATAATGAGAAGGG - Intronic
1008513784 6:52300616-52300638 CAGCACAAACAGACTAAGACAGG - Intergenic
1008523568 6:52385241-52385263 CAGTAGAGAGAGAATGAGAGGGG - Intronic
1008643273 6:53486535-53486557 CAGGAGAAACTGAATAAGATGGG - Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1008802505 6:55386944-55386966 CAACAGAAACAACAGGAGAACGG + Intronic
1008822448 6:55650473-55650495 CAGCACAAACAGAGAGAGAGAGG - Intergenic
1008877416 6:56344795-56344817 CAGGAGGAAAAGAAAGAGAAGGG - Intronic
1010267272 6:73881050-73881072 TACCACAAACAGAATCAGAAGGG - Intergenic
1010396063 6:75393477-75393499 CAGAAAAAGCATAATGAGAAAGG + Intronic
1010484198 6:76390372-76390394 CAGTAACAACAGAATAAGAATGG - Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010939671 6:81901500-81901522 CTGCAGAAACTAAATAAGAAAGG - Intergenic
1010940696 6:81914046-81914068 CAGCAGAAACATAATGTTATTGG + Intergenic
1010947449 6:81994134-81994156 AAGCAGAAACAAAATTACAATGG + Intergenic
1010974406 6:82296238-82296260 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1010991941 6:82489545-82489567 CAGAAGAAACAAAAAGAGATGGG + Intergenic
1011054049 6:83186508-83186530 CAACAGACACAGTGTGAGAAGGG + Intronic
1011151098 6:84274188-84274210 GATCAGAAAGAGAACGAGAATGG + Intergenic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1013236825 6:108204221-108204243 CAGGAGAGACAGAAAGAGATTGG - Intergenic
1013293489 6:108738590-108738612 CAAAAGAAAGAGAAAGAGAAAGG + Intergenic
1013440478 6:110160370-110160392 CATTAGATACAGAATAAGAAAGG + Intronic
1014220514 6:118794479-118794501 TAGCAGACACTGAATGAGCAAGG - Intergenic
1014609940 6:123529934-123529956 CAGCAGAAGCAAATTAAGAAAGG - Intronic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1015072106 6:129106957-129106979 CCAGAGAAACTGAATGAGAATGG + Intronic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1015901447 6:138072209-138072231 CAGAAGAGAAAGAATGGGAAAGG + Intergenic
1015943929 6:138480279-138480301 CATCTGAAACCAAATGAGAATGG - Intronic
1016154870 6:140793018-140793040 CAGCAGAAAATGAGTGACAAGGG - Intergenic
1016157456 6:140829442-140829464 CAGCAGAAAGAAAAAGAGAAAGG - Intergenic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1016550841 6:145278283-145278305 CAGCTGAAGCAAAAAGAGAAAGG + Intergenic
1017422580 6:154288118-154288140 CTACAGAAAAAGAAAGAGAAGGG + Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018043544 6:159946068-159946090 CAGCAGCCACAGCCTGAGAAGGG - Intergenic
1018209387 6:161465811-161465833 AAGAAGAAAAAGAAAGAGAATGG - Intronic
1018234919 6:161714588-161714610 CAGCACAAACAGACTAAGACAGG + Intronic
1018345441 6:162894044-162894066 CAGCAAAACCAGAATGAAAAAGG - Intronic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1020492323 7:8802917-8802939 CAGCATAAACAGACTAAGAATGG - Intergenic
1020641516 7:10759800-10759822 TAGCAGAAACAGTATGAACATGG - Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021073379 7:16271598-16271620 CAGAAGTAACAGTATGTGAAAGG - Intronic
1021176206 7:17452664-17452686 CAGCAAGAAGATAATGAGAAAGG + Intergenic
1021292349 7:18862260-18862282 CAAGAGAAAGAGAATGTGAAGGG + Intronic
1021403647 7:20238495-20238517 CAGCAGAGAAAGAATGAGATTGG + Intergenic
1021530321 7:21636862-21636884 CAGAAGTAAAAGACTGAGAAAGG + Intronic
1021562511 7:21982525-21982547 CAGTGGAAACAGAAAGAGATTGG - Intergenic
1022055942 7:26734525-26734547 CAGCATAAACAGACTAAGACAGG - Intronic
1022071653 7:26922078-26922100 CAGCTGAGAAAGAATGAAAAAGG + Intronic
1022637555 7:32151228-32151250 CCCCACAAACAGAATGATAAAGG + Intronic
1023139943 7:37091817-37091839 CAGGCAAGACAGAATGAGAACGG + Intronic
1023540999 7:41265697-41265719 CTGCAGTAAAAGAATGAGAGTGG - Intergenic
1023714024 7:43024880-43024902 CAGCAGCAACACAGTGAGTAGGG - Intergenic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1023930955 7:44706285-44706307 CAGCAGAAACAGAGTAAACATGG + Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024472747 7:49780225-49780247 CAATAGACACAGAATCAGAATGG - Intronic
1024841432 7:53591464-53591486 CAGCATAGAGAGTATGAGAAGGG + Intergenic
1025232092 7:57209408-57209430 CAGGTGAAATAGAAAGAGAAGGG + Intergenic
1026284985 7:68955124-68955146 AAGCAGAAAGAGAAAGAGAGGGG + Intergenic
1026439298 7:70429918-70429940 GATTAGAAACAGAATGTGAAGGG + Intronic
1026521520 7:71122208-71122230 TAGCAAATATAGAATGAGAAAGG + Intergenic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1026965715 7:74438585-74438607 CAGCACAAACAGAGTGAGACAGG - Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1030744214 7:113145632-113145654 CAGCAGAAACAAAAAGAAAGAGG - Intergenic
1030758784 7:113324410-113324432 GAGCAGAAACACAATGAGACAGG - Intergenic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1031372469 7:120984836-120984858 TAGCAGACAATGAATGAGAAAGG - Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031435838 7:121730646-121730668 CAGCAGAAACAATAAGACAAAGG - Intergenic
1031772042 7:125856179-125856201 CAGCAGAAAAATAATAATAAAGG - Intergenic
1031875881 7:127140543-127140565 TAACAGCACCAGAATGAGAAGGG - Intronic
1032300467 7:130681736-130681758 CAGCAGAAAGGGAATGGAAAAGG - Intronic
1033031085 7:137827458-137827480 CAGCAGGAATTGCATGAGAAAGG - Intronic
1033809528 7:144994915-144994937 CTGCAGAAACAGAATCGGAAAGG + Intergenic
1034300471 7:150010817-150010839 CAGATGGAACAGAATGAGAAAGG + Intergenic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034805583 7:154086491-154086513 CAGATGGAACAGAATGAGAAAGG - Intronic
1035032969 7:155874499-155874521 GAAGAGAAACAGAAAGAGAAAGG + Intergenic
1035090258 7:156304556-156304578 CTGCAGATACAGAGCGAGAACGG - Intergenic
1035091250 7:156313440-156313462 AAGCAGAAACAGTTTGAAAAGGG - Intergenic
1035587484 8:787004-787026 CAAAAGAAAAAGAAAGAGAAAGG - Intergenic
1035672553 8:1431486-1431508 CAGCAGAAAGAAGAAGAGAAAGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036409549 8:8486467-8486489 CAGGAGAAAAACAATTAGAATGG - Intergenic
1036467836 8:9018192-9018214 GGGAAGAAACAGTATGAGAAAGG - Intronic
1036499298 8:9298522-9298544 CAGAAGAGACAGAAAGTGAAGGG - Intergenic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1037292523 8:17366439-17366461 CAGCATCAGCAGAATGGGAAGGG + Intronic
1037436340 8:18867642-18867664 CAGCATGAAATGAATGAGAATGG + Intronic
1037483985 8:19330418-19330440 AAGAAGAAAGAGAATGAGATGGG - Intronic
1038087007 8:24209457-24209479 AAGCAGAAAGAAAATGACAAAGG + Intergenic
1038669118 8:29567673-29567695 CAGCAGTAAAAGAAAGAGAAAGG + Intergenic
1038706767 8:29901594-29901616 TAGCAGGAACAGAATGAGATGGG - Intergenic
1038931951 8:32203259-32203281 AACCAGAAACAGAAGAAGAAAGG + Intronic
1039041871 8:33416151-33416173 CAGAAGAAACAGAAATAAAATGG + Intronic
1039414742 8:37384248-37384270 CAACAGAAATAGAACCAGAAGGG + Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1040374194 8:46807153-46807175 CAGAAGAAACAAAAAGAGATGGG - Intergenic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1040616568 8:49043505-49043527 CAGCACCTACAGAAGGAGAAGGG + Intergenic
1040825146 8:51612299-51612321 CAGCAGATATAGGAGGAGAAAGG + Intronic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1041009098 8:53523985-53524007 CAGCAGACACAGAGTTAAAAGGG - Intergenic
1041492460 8:58449621-58449643 AAGCAGAAACAGATGGAAAAAGG + Exonic
1041507006 8:58610303-58610325 CAGTTAAAGCAGAATGAGAAGGG - Intronic
1041793848 8:61725646-61725668 CAGAATAAACAGACTGAGATAGG - Intergenic
1042089253 8:65140822-65140844 CCGCTGGAACAGAGTGAGAACGG + Intergenic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1042522842 8:69732633-69732655 CAGCAGAAAGACCATGAGCAGGG + Intronic
1042522984 8:69733980-69734002 CAGCAGAAAGACCATGAGCAGGG + Intronic
1043129602 8:76444705-76444727 CAGAAGGTACAGAATGAAAAGGG + Intergenic
1043466198 8:80509730-80509752 CAGTGGAAAAAGAATGAGATGGG - Intronic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1043863079 8:85343882-85343904 AAGCAGAAAAAGAAGGATAAAGG - Intronic
1043917593 8:85940538-85940560 CAACAGAGAGAGAATGAGGAAGG + Intergenic
1044140794 8:88649082-88649104 AAACAGAAACAGAATGAATAGGG - Intergenic
1045317780 8:101058285-101058307 CAGCAACAAAGGAATGAGAATGG + Intergenic
1047448752 8:124943643-124943665 AAGCAGAAAGAGAGAGAGAAAGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047895155 8:129358410-129358432 CCCCATAAACAGAATGAGAATGG - Intergenic
1048384370 8:133897899-133897921 CAGGAGAAACAGAATGTGTGAGG - Intergenic
1048629022 8:136220350-136220372 GAGAAGGAACAGAAAGAGAAGGG + Intergenic
1048750714 8:137670900-137670922 CATCAGAAACAAGATAAGAATGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1049850686 8:144828539-144828561 CAGCAGGAATAGCATGTGAAAGG - Intronic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050302684 9:4275456-4275478 CAGCACATAAAGAATGAGATTGG + Intronic
1050346095 9:4689201-4689223 CAACAGCAACAGCATGAGACGGG + Intronic
1050447589 9:5741760-5741782 TGGCAGAAACAGACTCAGAAAGG - Intronic
1050694845 9:8267147-8267169 TGGCTGAAACAGAATGTGAAAGG + Intergenic
1051811432 9:21054084-21054106 CAGGAGAAAGAGAGAGAGAAAGG - Intergenic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1052709526 9:32036652-32036674 GAGGAGACACAGAATGAGACAGG + Intergenic
1053294186 9:36901262-36901284 CAGAAGGAACAGCATGATAAAGG - Intronic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054743088 9:68828200-68828222 CAGGAGAAACAGAAGAGGAAGGG - Intronic
1055160668 9:73122743-73122765 CAGAAGGAACTGAATTAGAAAGG + Intergenic
1055662405 9:78518304-78518326 CAGAAGAGACAGAATGGGACTGG + Intergenic
1056063209 9:82906509-82906531 TAGGAGAAAAAGAAGGAGAAGGG + Intergenic
1056195921 9:84228565-84228587 CAGTAGAATCACAATGGGAACGG - Intergenic
1056482952 9:87024303-87024325 CAGTAGCAAGAGAAAGAGAAGGG + Intergenic
1057537748 9:95931223-95931245 GGGCAGAAACAGACTGAGAGGGG - Intronic
1058505438 9:105661511-105661533 GAGCAGGAACAGAATGATGAAGG - Intergenic
1058509319 9:105699535-105699557 CACCAGAAGCAAAATGATAAAGG + Intronic
1058858641 9:109092111-109092133 CTGAAGAGAAAGAATGAGAAAGG - Intronic
1059037356 9:110769431-110769453 CAGCATTGACAGAATAAGAAGGG + Intronic
1059099521 9:111456369-111456391 CAGCAGAGTAAGAATAAGAATGG + Intronic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1059647588 9:116282756-116282778 CAGCAAACAGATAATGAGAAGGG + Intronic
1060745497 9:126128219-126128241 TAGCAGCAAGAGAGTGAGAAGGG - Intergenic
1060841717 9:126798880-126798902 CAGCACAAACAGACTGAGAGAGG - Intergenic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1061919025 9:133772112-133772134 CAGCAAACACAGAATGAGCCTGG - Intronic
1061998620 9:134204289-134204311 AATCAGAAACAGAAGGAGCAGGG - Intergenic
1062164027 9:135096665-135096687 CAGCAGCTGCAGAATGACAAGGG - Intronic
1186424839 X:9455700-9455722 AAGTAGAAAGAGAAGGAGAAAGG - Intergenic
1186687913 X:11944865-11944887 CAGCAGTAGCACACTGAGAATGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188706888 X:33345375-33345397 CATCAGTAACAGCAAGAGAATGG - Intergenic
1189105791 X:38233903-38233925 AAGCAGCAACAGAATCAGTAAGG - Intronic
1189400138 X:40660303-40660325 CAGCATATACAGAAGTAGAATGG - Intronic
1189512689 X:41679256-41679278 CAGCAGAGATTGAATGGGAAGGG - Intronic
1189522251 X:41782181-41782203 CAGGAGGAACAGAATAGGAATGG + Intronic
1189761242 X:44323761-44323783 CAGCTGCAAGAGAAAGAGAAGGG + Intronic
1190114076 X:47614317-47614339 CAGCAGCTACAGCCTGAGAAGGG + Intronic
1190259363 X:48788190-48788212 CAGAAGACACACAATGAGACAGG + Intronic
1190735766 X:53255243-53255265 AGGAAGAAAGAGAATGAGAAAGG + Intronic
1190832037 X:54067466-54067488 CACCAGAAACAAAGGGAGAAAGG + Intergenic
1190888577 X:54550429-54550451 GAGCACATACAGAAAGAGAACGG + Intronic
1191798151 X:65045552-65045574 CAGAAGAATTAGAATCAGAAGGG - Intergenic
1193691316 X:84647857-84647879 CAGAAGAAATATAATGATAAGGG - Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1195292202 X:103440131-103440153 CAGCAAAAACAGACTAAGACAGG + Intergenic
1195548125 X:106136553-106136575 CATCAATAACAGAATGACAATGG + Intergenic
1196423203 X:115543964-115543986 CAGCAGAGAGAGAGAGAGAAAGG - Intergenic
1197129684 X:122990748-122990770 CAGCAGAAGCTCAATGAAAATGG - Intergenic
1197705584 X:129632369-129632391 CAGCACAAACAGACTAAGACAGG + Intergenic
1198233289 X:134713938-134713960 CAGCTGGAACCGAATGAGAAGGG + Intronic
1198469747 X:136935098-136935120 CAGCAGACACAGAGTTAAAAAGG - Intergenic
1198581205 X:138066665-138066687 CAGCTGAAAGAGAATGGGAGTGG - Intergenic
1199736082 X:150687966-150687988 CAGCACAAACAGACTAAGACAGG + Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1199901972 X:152183983-152184005 CAGAAAAAAAAGAATGTGAAAGG - Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200718236 Y:6574654-6574676 AATCATAAACAGAATGTGAAGGG - Intergenic
1201931719 Y:19357385-19357407 TAGCAGAAAAACAATGAGTATGG + Intergenic