ID: 1169818945

View in Genome Browser
Species Human (GRCh38)
Location 20:9687976-9687998
Sequence TCCAGGAAGGCTCTGAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169818940_1169818945 0 Left 1169818940 20:9687953-9687975 CCATTCCAGAATTGAATGCTGGG 0: 1
1: 0
2: 1
3: 5
4: 144
Right 1169818945 20:9687976-9687998 TCCAGGAAGGCTCTGAGATGTGG 0: 1
1: 0
2: 4
3: 50
4: 357
1169818942_1169818945 -5 Left 1169818942 20:9687958-9687980 CCAGAATTGAATGCTGGGTCCAG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1169818945 20:9687976-9687998 TCCAGGAAGGCTCTGAGATGTGG 0: 1
1: 0
2: 4
3: 50
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169818945 Original CRISPR TCCAGGAAGGCTCTGAGATG TGG Intronic
900610028 1:3540775-3540797 GCCAGGAAGGCTCTGCCGTGGGG - Intronic
900755327 1:4430556-4430578 ATCAGGAAGGCTCTGAGATTTGG - Intergenic
901919354 1:12525414-12525436 TCCAGGAAGGGTCAGTGATGGGG + Intergenic
901989044 1:13097653-13097675 CCCAGGAAGGCTGGTAGATGGGG - Intergenic
901992769 1:13129114-13129136 CCCAGGAAGGCTGGTAGATGGGG + Intergenic
904250569 1:29221226-29221248 TCCATCAAGGCCCTGAGAAGGGG - Intronic
904966391 1:34377614-34377636 TCCAGAGAGGTTCTGAGATTGGG - Intergenic
905271446 1:36790247-36790269 TCCAGAAAGGATCCGAGATGAGG - Intergenic
905300814 1:36985218-36985240 TCCAGGAAGAGACTGAGATGGGG + Intronic
905479812 1:38253967-38253989 TCCAGGAAGGATTTTTGATGCGG - Intergenic
905923089 1:41732053-41732075 TCTAGGAAGGCTGTGGCATGTGG + Intronic
906157950 1:43625184-43625206 CCCAGGCAGGCTCTGCGCTGAGG + Intergenic
906241558 1:44245306-44245328 TCCAGGCTGGCTCTGAGGTGTGG - Intronic
907629447 1:56065466-56065488 TCCAAGAAGGCTCTGAGAAGGGG - Intergenic
908064891 1:60392102-60392124 CCCAGGAAGACTCAGAGATATGG - Intergenic
909043846 1:70686101-70686123 TCCAGGAAGGGTGTGCCATGGGG - Intergenic
909489261 1:76208136-76208158 TCTTGGTAGGCCCTGAGATGAGG - Intronic
910718482 1:90258250-90258272 ACCAGGGAGGCTCTGGGGTGGGG + Intergenic
911137568 1:94457620-94457642 CCCAGGAAGTCTGTGACATGAGG - Intronic
914213598 1:145604627-145604649 TCTAGGAAAGTTTTGAGATGGGG + Intergenic
914803502 1:150976356-150976378 TCCAGAAAGGGCCTGAGATGAGG - Intergenic
915280166 1:154816979-154817001 TAAACAAAGGCTCTGAGATGGGG - Intronic
915291629 1:154888087-154888109 ACAAGGAAGGCTCTGAGTGGTGG - Intergenic
915318294 1:155042028-155042050 TACAGCAAAGCTCTGAGCTGTGG + Intronic
916492305 1:165312706-165312728 TCCAGGATGGCTCACACATGGGG - Intronic
917286229 1:173424092-173424114 TCCAGGAAGGCTCTGCTCTCAGG + Intergenic
917741507 1:177965857-177965879 TCCAAGAAGCCTCTGGGATTTGG - Intronic
919979233 1:202632051-202632073 TGCAGGAAGGGGCTGAGGTGGGG + Intronic
920312350 1:205056203-205056225 TCCAGGAACGCTGGGTGATGGGG - Intronic
920385498 1:205568366-205568388 CCCTGGAAGGGCCTGAGATGAGG - Intergenic
921278877 1:213545869-213545891 TCCCGGACAGCTCTGGGATGGGG + Intergenic
921621194 1:217328316-217328338 TCCAGGAAGTATCTGAGCTCTGG + Intergenic
922161200 1:223080294-223080316 TCACGGAGGGCTCTGAGCTGAGG - Intergenic
922596962 1:226821578-226821600 GCCAAGAAGGCTCACAGATGAGG - Intergenic
923568484 1:235094028-235094050 ACCAAGAAGGCGCTGAGAGGCGG + Intergenic
923671094 1:236042083-236042105 TCCTACAAGGCTCTGAGAAGGGG - Exonic
1063665274 10:8056949-8056971 TCAAGGCAGGCTCTGAGTAGGGG - Intronic
1064414150 10:15134362-15134384 ACCAGGAAGGCCCTGAGCTGAGG - Intronic
1065587839 10:27237846-27237868 TCGAGGCAGGCCCTGAGATCAGG - Intronic
1067179798 10:43976155-43976177 CCTAGGAAGACTCTGAGAGGTGG - Intergenic
1069571620 10:69497786-69497808 TCCAGGCAGGTTGTGAGGTGTGG + Intronic
1069590116 10:69636193-69636215 CCCTGAAAGGCTCTGAGAGGCGG - Intergenic
1069760856 10:70810021-70810043 TGCAGGAGGGCCCTGACATGTGG + Intergenic
1069800286 10:71077688-71077710 TCAAGGAGGGCTCTCAGAGGAGG - Intergenic
1069806220 10:71126680-71126702 GTCGGGAAGGCTCTGAGCTGAGG - Intergenic
1069872305 10:71540608-71540630 GAAAAGAAGGCTCTGAGATGGGG + Intronic
1070546980 10:77460234-77460256 TACAGGAAGAATCTGAGAGGTGG - Intronic
1070946465 10:80395914-80395936 TGCAGGAAGGACCTGAGAAGTGG - Intergenic
1071825634 10:89322740-89322762 TCCAGAAAGGGTTTGAGATGGGG - Intronic
1072457724 10:95591357-95591379 TCCAGGATGGCCAGGAGATGAGG + Intergenic
1074293236 10:112157471-112157493 GCCAGGAAGGGTCAGAGAAGAGG - Intronic
1075121818 10:119669966-119669988 TCCATGAAGGCGCTGAGAACCGG + Exonic
1077092025 11:782936-782958 CCCAGCAAGGCTCAGAGCTGCGG + Intronic
1077137065 11:1005596-1005618 TCAAGGCAGGCGCTGAGAGGAGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1078437971 11:11341022-11341044 GCCAGGCAGGCTCTGACAAGTGG - Intronic
1078654229 11:13223203-13223225 CCCAGGAAGGCTGTGAACTGAGG + Intergenic
1081110908 11:39132026-39132048 TTAAGGAAGAGTCTGAGATGAGG - Intergenic
1082717583 11:56633675-56633697 ACCAGGAGGGCACTGAGGTGGGG + Intergenic
1083304116 11:61753895-61753917 TCCAGGGAGGTTCTGAGAAGCGG - Intronic
1084766612 11:71313285-71313307 GCCAGAAAGGCTCTGTGATTTGG + Intergenic
1085029704 11:73263610-73263632 TCCAGGAGGTTTCAGAGATGAGG + Intergenic
1085741821 11:79083650-79083672 GCCAGGAAGGCTCTCACAGGAGG - Intronic
1086060939 11:82699175-82699197 CCCAGGAAGGCTCAGAGGTAGGG + Intergenic
1086970212 11:93073238-93073260 TCCTTGAAGGCTCAGAGATTAGG - Intergenic
1087149288 11:94844165-94844187 TCAAGGAAGGTTCTTGGATGTGG - Intronic
1087809356 11:102593664-102593686 TCTATGAAGGCTCTTAAATGGGG + Intronic
1088411027 11:109534903-109534925 TCCAATAAGGCTCTGAGGTTAGG - Intergenic
1088907705 11:114167274-114167296 GCCAGGAAGGCTCTCAGAGAGGG + Intronic
1089768028 11:120782711-120782733 AGCAGGAGGGCTCTGAAATGAGG + Intronic
1089775324 11:120831763-120831785 AGCAGGAAGGCACGGAGATGTGG - Intronic
1090035206 11:123243701-123243723 CCCAGGAAGACTTTGAGCTGGGG + Intergenic
1091616873 12:2056111-2056133 TCCCGACATGCTCTGAGATGTGG + Intronic
1091750446 12:3018707-3018729 TTCAGGATGGCTCTGAGCTCAGG + Intronic
1093070371 12:14701977-14701999 TCCATGTAGGCCCTGTGATGCGG + Intergenic
1093515491 12:19981490-19981512 TAAAGGAAGGCTCTGAAATGGGG - Intergenic
1093660662 12:21752987-21753009 TACAAGAAGACTGTGAGATGAGG + Intronic
1094583587 12:31756997-31757019 TCCTTGAAGGCTCAGAGATTAGG + Intergenic
1096541446 12:52309595-52309617 TCCAGGAAGGCCCTGGGGTGGGG - Intergenic
1096754803 12:53790354-53790376 TCCAGGAAGGCTCGGACAGGGGG - Intergenic
1096908951 12:54962887-54962909 TCCAGCAAGACTCTGATTTGGGG - Exonic
1098770968 12:74552451-74552473 ACCAGGAATGCCCTCAGATGTGG + Intergenic
1099110415 12:78553146-78553168 TCAAGGTAGACTCTGAGAAGAGG + Intergenic
1099223450 12:79940926-79940948 ACCAGGAAAGATCTGAGCTGAGG + Intergenic
1099923685 12:88990876-88990898 TCAATGAAGGCTGAGAGATGGGG + Intergenic
1101286802 12:103322379-103322401 CCCAGAAAGGTACTGAGATGTGG - Intronic
1101389180 12:104284743-104284765 TCCAGGAAGACTCCCAGAGGAGG + Intronic
1101815554 12:108143523-108143545 CACAGCAAGGCTCTGAGATGGGG - Intronic
1103963049 12:124621503-124621525 TGCAGGAAGGCTGTGGTATGCGG + Intergenic
1103989535 12:124789478-124789500 TGCATCAAGGCTCTCAGATGGGG + Intronic
1104093002 12:125531510-125531532 TCCAGGTAGGCTATGACATCAGG - Intronic
1104470975 12:129029368-129029390 TCCAAGAAAGCTCTCACATGAGG - Intergenic
1104754572 12:131261116-131261138 TCCAGGAAGCGTCTGCCATGTGG + Intergenic
1104898601 12:132176078-132176100 TGCTGGAAGGCTCTGGGCTGAGG - Intergenic
1104991898 12:132629594-132629616 TCCATGAAGGCTGAGAGCTGAGG - Intronic
1106521518 13:30502411-30502433 GCAAGGAAGGAACTGAGATGGGG - Intronic
1107243405 13:38264727-38264749 TTCAGGCAGGCACTGAGCTGCGG + Intergenic
1107315325 13:39125396-39125418 TCCAAGTAGGCTCTGTGATAAGG - Intergenic
1107905355 13:45056529-45056551 GCAAGGAAGGCTGGGAGATGGGG - Intergenic
1109426718 13:62174086-62174108 TCCAGGAAGGCACAGAGAGATGG - Intergenic
1111689517 13:91544906-91544928 TCCAGGAAGGCTCACTCATGTGG + Intronic
1112272973 13:97987076-97987098 TCCAAGAAGTCACAGAGATGGGG + Intronic
1112714694 13:102170157-102170179 TACAGGAAAACTCTGAGATGTGG + Intronic
1113618528 13:111697469-111697491 TCCTGGCTGGCTGTGAGATGGGG + Intergenic
1113624057 13:111782730-111782752 TCCTGGCTGGCTGTGAGATGGGG + Intergenic
1114141549 14:19916779-19916801 TCTAGGAAGGCTTTTAGAGGTGG + Intergenic
1114348306 14:21821218-21821240 TCCAGGAAGGCTGAGTCATGGGG - Intergenic
1114609103 14:24024850-24024872 TCCATGAAGGGTCTGTGCTGAGG - Intergenic
1114690467 14:24575482-24575504 TCCAGAAAGGCTGGAAGATGGGG + Intronic
1115022030 14:28693596-28693618 TGCAGGAGGGCTCTGAAAGGTGG - Intergenic
1115087226 14:29532164-29532186 TACAGGAAAGCTTTGAGCTGTGG - Intergenic
1117881208 14:60315397-60315419 GCCTGGGAGGCTCTGGGATGGGG - Intergenic
1118030192 14:61811845-61811867 TTCAGGAGGGCTCTGAACTGAGG - Intergenic
1118717869 14:68573149-68573171 TGCTGGAAGGCTCTGAGCAGTGG - Intronic
1119012494 14:71008782-71008804 TCCACGAAGGCAATGAAATGAGG - Intronic
1119105257 14:71917322-71917344 ACCAGGCAGCCTCTGTGATGAGG - Intergenic
1119109988 14:71962981-71963003 CCCAGGCAGCCTCTTAGATGAGG + Intronic
1119228110 14:72959708-72959730 TCCAGGAAGGCTATGAAAGCTGG - Intergenic
1119925769 14:78491955-78491977 ACCAGGAAGGTGCTGAGATTCGG + Intronic
1121035987 14:90704027-90704049 GCCAGGCATGCACTGAGATGGGG + Intronic
1121224975 14:92315090-92315112 TCCAGGAAGGCTGGGACATGGGG - Intergenic
1121903534 14:97717914-97717936 TCCAGAAACTTTCTGAGATGGGG + Intergenic
1122830862 14:104394935-104394957 CCCAGGAAGGCTCTGAAATCTGG + Intergenic
1122953959 14:105061331-105061353 TCCAGGAAGGCCCTCGGAAGAGG - Intronic
1123724215 15:23086095-23086117 ACCAGGAAGGGTCAGAAATGTGG - Intergenic
1124101838 15:26703070-26703092 TTCAGGAAGGCTCTGACATCAGG + Intronic
1124494833 15:30180007-30180029 TGCAGGAAGGGGCTGAGGTGGGG + Intergenic
1124748736 15:32358638-32358660 TGCAGGAAGGGGCTGAGGTGGGG - Intergenic
1127406250 15:58650389-58650411 TCCAGTTAGGGACTGAGATGTGG + Intronic
1128402140 15:67294400-67294422 TTGAGGAAGGCTCAGAAATGAGG - Intronic
1128509052 15:68302448-68302470 TGAAGAAAGACTCTGAGATGTGG - Exonic
1128673000 15:69588259-69588281 GCCAGGAAGGCTGTGAAATGTGG - Intergenic
1128724151 15:69975442-69975464 TGCAGGAAGGCACTCAGAAGGGG - Intergenic
1128778543 15:70342407-70342429 TCTAGGTAGGCTCAGAGATTGGG + Intergenic
1129173168 15:73820375-73820397 TACAGAAAGGCTCAGAGACGGGG + Intergenic
1129276323 15:74448091-74448113 ACCAGGCAGGCACTGAGCTGGGG - Intronic
1129348453 15:74939287-74939309 TCCACGATGGCTCTGAAATAGGG + Intergenic
1130365339 15:83233007-83233029 TCCAGGAAGGATATTAGATCTGG - Intergenic
1132554441 16:566368-566390 TCCAGGAAGCCTCTGGGTAGAGG - Intergenic
1132606089 16:794340-794362 GCCAGGAAGTCTCTGAGGTGGGG + Intronic
1132824790 16:1898867-1898889 TGCAGGAAGGCACTGACATCAGG - Intergenic
1132905180 16:2278809-2278831 TCCAGGATGGAGCTGGGATGTGG - Intronic
1133424438 16:5675603-5675625 TCCAAGAAGGCTCAGTGTTGAGG - Intergenic
1134625733 16:15721229-15721251 TCGAGGATGGGTCTGAGTTGGGG - Intronic
1134886639 16:17799035-17799057 TCCAGGAAAACACTGACATGTGG - Intergenic
1135506057 16:23037323-23037345 TACAGAAAGGTTCTGAGATGGGG - Intergenic
1137251103 16:46741563-46741585 CCCAGCAAGGCTCTGGGCTGTGG - Intronic
1139335868 16:66230800-66230822 TCCACAAAGGCTCTGGGAGGTGG + Intergenic
1139341496 16:66270637-66270659 TCCAGGAAGGCGTGGAGACGCGG - Intergenic
1139597707 16:67968098-67968120 GCCGGGAAGGGCCTGAGATGGGG + Intronic
1139717188 16:68822953-68822975 TCCAGGAAGTCACAGATATGGGG - Intronic
1139914334 16:70418896-70418918 TCCAGGAAGCCTCTGGTGTGGGG - Intronic
1140717527 16:77740035-77740057 TCCAGGTGGACTCTGAGATAAGG - Intronic
1140973607 16:80037790-80037812 TCCAGGAAGTATATGAGATCTGG - Intergenic
1142155184 16:88529787-88529809 TCCAGGGAGGGTCAGAGAGGAGG + Intronic
1142257998 16:89024542-89024564 TCCAGGAGGGCCCTGAGTTTTGG + Intergenic
1142480072 17:213688-213710 TGCAGAAAGGCACTGAGCTGGGG + Exonic
1143724923 17:8838155-8838177 TCAAGGGAGGCTCCGAGCTGAGG - Intronic
1144570036 17:16391731-16391753 TCTAGGAAGTCCCAGAGATGAGG - Intergenic
1145205626 17:20983778-20983800 CCAAGGTAGGCTCTGAAATGTGG + Intergenic
1147355890 17:39896396-39896418 TCCAGGAAACCTCAGAAATGAGG - Intergenic
1148752983 17:49956345-49956367 TCAGGGAATGCTGTGAGATGGGG - Intergenic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1151107972 17:71640312-71640334 TCCAGGAAGACTCTGCTATAAGG + Intergenic
1151727564 17:75893585-75893607 TCCCGCAATGCACTGAGATGGGG + Intronic
1152202334 17:78954406-78954428 TCCAGGGAGGCTGTCAGAGGTGG - Intergenic
1152261114 17:79267798-79267820 CCCAGGAAGGGTCTAAGGTGTGG + Intronic
1152264755 17:79287775-79287797 TCCAGGAAGCTTCTGAGACCGGG - Intronic
1152782238 17:82231518-82231540 TCCAGGAGGCCTCGGAGGTGGGG + Intronic
1152824158 17:82453736-82453758 TGCAGAAAGGCTCCCAGATGGGG + Intergenic
1153817336 18:8801853-8801875 TCCAGGAGGGCTCTGGGCTGTGG - Intronic
1153977630 18:10283472-10283494 TCCAGGAAGGCTGGGACATGAGG - Intergenic
1155344619 18:24846235-24846257 TCCAGGTAGGCTGTCAGATCTGG + Intergenic
1155357137 18:24964254-24964276 TCCCGGAAGGCTCAGAGGTTAGG + Intergenic
1157389294 18:47287976-47287998 TCTATGAAGTCTCTGAGCTGGGG + Intergenic
1157526480 18:48386538-48386560 TCCAGAATGGCTCTGATGTGTGG - Intronic
1157790157 18:50524302-50524324 TCCATGAAGGCTCTGAGACACGG - Intergenic
1158435749 18:57434982-57435004 TCCAGGAAAGCTTTGGGGTGAGG + Intergenic
1158963156 18:62602897-62602919 TACAGGAAGGGTCTGGGAGGTGG + Intergenic
1160236064 18:77087749-77087771 TCCAGGCAGGCGCTGGGATGGGG + Intronic
1160347845 18:78149442-78149464 TCCATGAAAGCTGAGAGATGAGG - Intergenic
1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG + Intergenic
1160460197 18:79033408-79033430 TCATGGAAGGCTCTGAGACATGG - Intergenic
1160460210 18:79033482-79033504 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460236 18:79033630-79033652 TCATGGAAGGCTCTGAGACATGG - Intergenic
1160460262 18:79033778-79033800 TCATGGAAGGCTCTGAGACATGG - Intergenic
1160460340 18:79034222-79034244 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460353 18:79034296-79034318 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460366 18:79034370-79034392 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460379 18:79034444-79034466 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460431 18:79034740-79034762 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460470 18:79034962-79034984 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460496 18:79035110-79035132 TCATGGAAGGCTCTGAGATATGG - Intergenic
1160460574 18:79035554-79035576 TCATGGAAGGCTCTGAGACATGG - Intergenic
1160460586 18:79035628-79035650 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460638 18:79035924-79035946 TCATGGAAGGCTCTGAGATATGG - Intergenic
1160460754 18:79036590-79036612 TCGTGGAAGGCTCTGAGATATGG - Intergenic
1160460767 18:79036664-79036686 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460780 18:79036738-79036760 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460806 18:79036886-79036908 TCGTGGAAGGCTCTGAGATATGG - Intergenic
1160460819 18:79036960-79036982 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460912 18:79037412-79037434 CCTTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460968 18:79037638-79037660 TCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460981 18:79037714-79037736 CCCTGGAAGGCTCTGAGACATGG - Intergenic
1160529472 18:79555149-79555171 TTCAGGAAGTCACAGAGATGGGG + Intergenic
1160686167 19:437855-437877 TCCTGGAGGGCTCTGGGAGGTGG - Intronic
1160827211 19:1086154-1086176 TCCTGGAAGCCTCTGGGAGGAGG - Exonic
1161364708 19:3871673-3871695 TCCAGGAAGTCACAGAGATGGGG - Intergenic
1162321580 19:9973879-9973901 GCCAGGAAGGCTCAGAGATGGGG - Intronic
1162414184 19:10524502-10524524 TTCTAAAAGGCTCTGAGATGAGG - Intergenic
1164425451 19:28137593-28137615 TCCATGAAGGCTCTGTGCAGCGG + Intergenic
1164801468 19:31080271-31080293 TGGAGGAAGGCTGGGAGATGTGG + Intergenic
1165434560 19:35788926-35788948 TCCTGGGAGCCTCTGAGAGGTGG + Intergenic
1166523707 19:43497937-43497959 CCCAGGCAGGCTCTGAGATATGG - Intronic
1166593938 19:44027703-44027725 GCCAGAAAGGCTTTGAGCTGAGG - Intronic
1166872889 19:45881800-45881822 TCCAGAGAGCCTCAGAGATGAGG - Intergenic
1167603742 19:50469054-50469076 CACAGGAAGGCTCTGAGCAGAGG - Intronic
1168147950 19:54430116-54430138 TCCAGGAGGGCTCCGAGCTGGGG - Intronic
925786248 2:7434015-7434037 TCCTTGAAGGATTTGAGATGGGG + Intergenic
925976474 2:9145721-9145743 TTCAGGAAGGCTCTGGTAAGTGG + Intergenic
927906358 2:26861199-26861221 ACAAGAAAGGCTCTGAGATCAGG + Intronic
928202476 2:29257140-29257162 CCCAGGGAGGATCTGGGATGGGG + Intronic
929090794 2:38215336-38215358 TCAAGGAAGGCTCTTGGGTGGGG - Intergenic
929602448 2:43212875-43212897 TCCAAGGAGGCTCTGGGATCCGG - Intergenic
931590135 2:63874018-63874040 TCCAGGAAGTCTCTGTGAAAGGG - Intronic
932848921 2:75164744-75164766 TCCTGGAAGGCTCTGTCATTTGG + Intronic
932895106 2:75631825-75631847 TCCAGGAAGCATCAGTGATGGGG - Intergenic
933215648 2:79626828-79626850 TCTTGGAGGGGTCTGAGATGAGG + Intronic
933301180 2:80543302-80543324 GGCAGGAAGGTTCTTAGATGTGG - Intronic
933414252 2:81965696-81965718 TCCATGAAGGCTGAGAGGTGAGG + Intergenic
933686838 2:85148206-85148228 TGCAGGAAGGGGCTGGGATGGGG + Intronic
934857805 2:97739735-97739757 TCCCGGAGGGCCCTGAGCTGAGG + Exonic
936079763 2:109424099-109424121 TGGAGGCAGGCCCTGAGATGGGG + Intronic
937126447 2:119477777-119477799 TGCATGAAGGCTTTGAGATGTGG + Intronic
938261077 2:129895444-129895466 TCCAGCAAGGCTCAGAGGAGGGG - Intergenic
944414261 2:199467501-199467523 TCCAGGTAGGCTCTGACTTCAGG + Intronic
945652298 2:212577977-212577999 TCCATGAAGGCTGAGAGATGAGG - Intergenic
945766741 2:213990028-213990050 TTCAGAAAGGATCTGACATGGGG + Intronic
946406169 2:219493097-219493119 TCTAGGAAGGTTCTGGGTTGGGG + Exonic
948407311 2:237731901-237731923 TCCAGGAAGGTTCTGAGGGTGGG - Intronic
948430532 2:237915734-237915756 CCCAGGAAGGCTCTGACAGCTGG - Intergenic
948658364 2:239491027-239491049 TCCAGGAAGCCCCTTAGGTGAGG + Intergenic
1169245905 20:4024286-4024308 TCCAGGAAGTCACAGAGATGGGG - Intergenic
1169818945 20:9687976-9687998 TCCAGGAAGGCTCTGAGATGTGG + Intronic
1170385738 20:15814431-15814453 TACAGAGAAGCTCTGAGATGTGG - Intronic
1172229983 20:33330117-33330139 TGCAGGATGGCTTTGAGAGGAGG - Intergenic
1172361789 20:34317788-34317810 TCCAGCAAGGATATGATATGTGG + Intergenic
1172620721 20:36316652-36316674 TCCAGGAAGGGCCTGAGAACAGG + Intronic
1175020794 20:55846681-55846703 TCCAGGGATGATCTGAGATCCGG - Intergenic
1175313561 20:58028683-58028705 TGCAGGAAGGCTCTCAGGGGAGG - Intergenic
1175395967 20:58661922-58661944 TGCAGGAAGCCTCTGAAGTGAGG - Intronic
1175806465 20:61831882-61831904 TTCCAGAAGGCTATGAGATGTGG + Intronic
1177714747 21:24824494-24824516 TCTAGGTAGGCTCTGACAGGAGG + Intergenic
1178158313 21:29880917-29880939 TCCAGGAAGGCTAGGTGATAAGG + Intronic
1179325572 21:40340022-40340044 TCCATGAAGTCTCTGAGAATGGG + Intronic
1179342918 21:40529592-40529614 TCCAGGCAGGTGCTGATATGAGG - Intronic
1180253127 21:46602793-46602815 TCCTGCAAGGCTCCAAGATGAGG + Intronic
1180711698 22:17843551-17843573 TCCATGACGGCTCTGGGAGGTGG - Intronic
1181311336 22:21946473-21946495 GCCAGGAGGGCTCTGAGGTGAGG + Intronic
1181419769 22:22789631-22789653 TCCAGGCAGGCTCTGAAGAGGGG + Intronic
1182058506 22:27379926-27379948 CTCAGGAAGGCTCTCAGAGGTGG - Intergenic
1183558045 22:38546764-38546786 TTCAGAAAGACTGTGAGATGGGG + Intronic
1184508956 22:44920993-44921015 TACAGAAATGCTCTGTGATGTGG - Intronic
1185045701 22:48527726-48527748 CCCAGGAAGGGTCTGAGCTAGGG - Intronic
949872745 3:8603155-8603177 CCCAAGAAGTCTCTGAGAGGAGG + Intergenic
950193794 3:10995021-10995043 GCCAGGAAGGCTATAAAATGTGG + Intronic
950613146 3:14138939-14138961 TGCTGGCAGGCTCTGAGCTGAGG + Intronic
950679695 3:14576289-14576311 CTCAGGACGGCACTGAGATGCGG + Intergenic
952069032 3:29610498-29610520 TCAAGGAAGGCTCAAAGAAGGGG - Intronic
952544904 3:34408525-34408547 TCCCAGAAGACTCTGAGATAAGG + Intergenic
953404946 3:42655364-42655386 TCCAGGGAGGCTCTGAGGCAGGG + Intronic
953445756 3:42964352-42964374 TCTATGAAGGCTGAGAGATGAGG + Intronic
953925711 3:46981476-46981498 TCCAGGAAGCCCCTGAGGTCAGG - Intronic
954381479 3:50221296-50221318 TTCAGGGAGGGTCTGAGCTGGGG + Intergenic
954429636 3:50463679-50463701 TCCAGGGAGGGTGTGAGAGGTGG - Intronic
954716580 3:52529849-52529871 CCCAGGGAGGCTGAGAGATGAGG - Intronic
955044613 3:55348070-55348092 TCCTTGAAGGCTCTGAGAGGTGG - Intergenic
955458503 3:59152291-59152313 TATAGGCAGGCTCTGAGATGGGG - Intergenic
956166705 3:66402850-66402872 TCCAGGAAAGTTCTGCGCTGTGG - Intronic
956730659 3:72193831-72193853 TACAGTAAGCCCCTGAGATGAGG + Intergenic
956915527 3:73867184-73867206 TCCCGGAAGGCTTGGAGATTAGG - Intergenic
956972247 3:74539729-74539751 TCCATTAAGGCTCTAAGAAGTGG + Intergenic
957218817 3:77355526-77355548 AGCAGGAAGGTGCTGAGATGCGG + Intronic
958590744 3:96155147-96155169 TCCAGCAAGGGTTTGAAATGAGG + Intergenic
958952243 3:100429284-100429306 TCCAGGCAAGCTCTGAAATGGGG - Intronic
959532151 3:107445699-107445721 TCCAAGATGGCTCTGTCATGCGG - Intergenic
960949395 3:122989296-122989318 TCAAGGAGGGCTGTGAGCTGGGG + Intronic
960988660 3:123296401-123296423 TGCAAGCAGGGTCTGAGATGGGG - Intronic
961192696 3:124975418-124975440 TCCTGGAAGCCACTGAGATTGGG - Intronic
961787753 3:129357848-129357870 CCTCGGAAGGCTCTGAGATACGG + Intergenic
963002205 3:140692604-140692626 CACAGGAAGGATGTGAGATGGGG + Intronic
963103484 3:141626011-141626033 TCCTGGAAGGTACTCAGATGTGG - Intergenic
963838636 3:150082138-150082160 TCCAGGCATGTTCAGAGATGTGG - Intergenic
965233625 3:166086569-166086591 TTCTGGAAGTCTCTGAGCTGGGG + Intergenic
966117651 3:176484939-176484961 TCCAGGAGGGCTCTTAGCTTTGG + Intergenic
968213490 3:196868355-196868377 GCCGGGAAAGCTCTGAGAGGAGG + Intronic
969209299 4:5674359-5674381 TCCAGGGAGGCTCTGGGAACTGG - Intronic
969244132 4:5921581-5921603 TCCAGGGAGGCTCAGGGGTGGGG + Intronic
971375069 4:26049853-26049875 TCCAAGAAGGGACTGAGAAGAGG + Intergenic
971578397 4:28305065-28305087 TCTAGGAAGGCTAGGATATGGGG - Intergenic
972940908 4:44194150-44194172 TCCAGAAAGGTTCTGACATAAGG + Intronic
974668643 4:64999657-64999679 TCAAGACAGGCTCTGAGATCAGG + Intergenic
974997065 4:69174643-69174665 TCTATGAAGGCTGAGAGATGAGG + Intronic
975010031 4:69339606-69339628 TCTATGAAGGCTGAGAGATGAGG + Intronic
978021933 4:103824940-103824962 TCCAGTAAAGCTCTGAGATGAGG + Intergenic
978445616 4:108777440-108777462 TCCATGAAGGCTCAGAGGTTAGG + Intergenic
979105719 4:116684418-116684440 TCCAGGAGGGCACCCAGATGTGG + Intergenic
979520830 4:121664784-121664806 TCCATGAAGGCTGAGAGGTGAGG - Intergenic
981054927 4:140350886-140350908 TCCTAAAAGGCTCTGAGATCTGG + Intronic
985044061 4:185922410-185922432 TCCATGAAGGATCAGGGATGGGG - Intronic
985563758 5:604891-604913 TCCCCGAAGCCTCAGAGATGAGG + Intergenic
985793338 5:1944508-1944530 TCAAGGAGGGCTCTCAGATCTGG + Intergenic
989100805 5:37821252-37821274 TCCAGGAATTCACTGAGCTGAGG + Intronic
991254275 5:64597285-64597307 ACCATGCATGCTCTGAGATGAGG + Intronic
993350349 5:86842652-86842674 TCCATGAAGGATCTTAGAAGAGG + Intergenic
994979937 5:106861009-106861031 CCTAGTTAGGCTCTGAGATGTGG - Intergenic
996580146 5:125023016-125023038 TCCAGTAAGGGTCTCAGCTGTGG + Intergenic
996872448 5:128206620-128206642 TTCAGGAAGGCTTTGGTATGGGG - Intergenic
1000067974 5:157712905-157712927 GCCAGTAAGGTTCTGAGATGTGG - Intergenic
1000267677 5:159653305-159653327 TCAAGGGAGGCTCAGAAATGAGG - Intergenic
1000431487 5:161157834-161157856 TCTATGAAGGCAGTGAGATGTGG - Intergenic
1001446665 5:171790558-171790580 TCCAGCAAGGTACTGAGGTGAGG + Intronic
1002068643 5:176665287-176665309 TCCAGGAAGGCTATGAGCATCGG + Intergenic
1005055497 6:21725117-21725139 TCCAGGAAGGTTAAGAGATTTGG - Intergenic
1006025417 6:31143614-31143636 TCCAGGATGGTTCAGGGATGAGG - Intronic
1006375465 6:33669321-33669343 TCCAGGAAGGCTGAGTGAAGAGG + Intronic
1006908606 6:37549397-37549419 GCCAAGAGGGCTCTGAGCTGTGG - Intergenic
1007476295 6:42122108-42122130 CCCAGGAGGGGTCTGAGCTGTGG - Intronic
1010090704 6:71977617-71977639 TCAAGGAAGGCTCTAAGAGGAGG + Intronic
1014033454 6:116737504-116737526 GCCACAAAGTCTCTGAGATGGGG - Intronic
1015629269 6:135215282-135215304 TCCAGGAAAGTGCTGAGATGGGG - Intronic
1017074571 6:150605652-150605674 TCCAGGAAGCCTCTAGGAGGAGG + Intronic
1017220682 6:151962166-151962188 TCAAGGGAGTCTCTGAGATTGGG + Intronic
1017906156 6:158758724-158758746 TCCAGGTAGGCACTGGGAAGGGG - Intronic
1019542482 7:1557845-1557867 TCCAGGGAGGCTCCCAGGTGGGG + Intronic
1019574192 7:1728399-1728421 TCTTGATAGGCTCTGAGATGCGG + Intronic
1022855582 7:34310434-34310456 TGGAGGAAGAGTCTGAGATGGGG - Intergenic
1023006747 7:35878412-35878434 GCCAGGAATGCTAAGAGATGAGG + Intronic
1024067411 7:45752219-45752241 GCCAGGAATGCTAAGAGATGAGG - Intergenic
1024097707 7:45997684-45997706 TCCAGGAAGTCACAGAGATGGGG + Intergenic
1024417956 7:49129947-49129969 TCCAGGAAGGCTCTGGATTCTGG - Intergenic
1024883018 7:54111119-54111141 TCCAGGAGGGCTCTGTGAGTGGG + Intergenic
1024989842 7:55224465-55224487 GCTATGAAGGCTCTGAGAGGCGG - Intronic
1026362943 7:69619442-69619464 CACAGGAAGGCTCTGAGCTGTGG + Intronic
1026837239 7:73647316-73647338 TCCAGGTGGGCCCTGGGATGAGG - Intergenic
1029382900 7:100225084-100225106 CCCAGGAAGGCTCTGGGTGGAGG + Intronic
1029626389 7:101722636-101722658 CCCACGAAGGCTCTGAGAAAAGG + Intergenic
1029817681 7:103113509-103113531 TGCAGAGAGGCTCTGGGATGTGG + Intronic
1030150647 7:106401472-106401494 TCCAGGTGGGAGCTGAGATGAGG - Intergenic
1032069320 7:128794130-128794152 TCCAGGAAGGGCCTGGGAGGTGG + Intronic
1032152606 7:129442868-129442890 TCCAGGAAGGGTCTCAGGTAGGG + Intronic
1032681379 7:134187710-134187732 TCCAGGAAGTCACTGATTTGTGG - Intronic
1032805904 7:135353873-135353895 CCCAGGAAGACTCTGGGAAGTGG - Intergenic
1033355294 7:140594325-140594347 GCCAGGAAGGGTCTGGGGTGAGG - Intronic
1033534367 7:142298570-142298592 TCCTGGAATTCACTGAGATGAGG + Intergenic
1034094790 7:148397279-148397301 ACCAGGAATCCTCTGGGATGGGG - Intronic
1034900186 7:154903479-154903501 TCCAGAGAAGCTCTGAGATCTGG + Intergenic
1035171623 7:157020693-157020715 CCCAGGAAGGATCTGCGAGGAGG - Intergenic
1035836677 8:2761825-2761847 TCCAGAAAGATACTGAGATGGGG + Intergenic
1036632499 8:10525374-10525396 ATAAGAAAGGCTCTGAGATGAGG + Intergenic
1037761125 8:21742402-21742424 TCCATAAAGGCCCTGTGATGAGG - Intronic
1037876270 8:22550246-22550268 TCCAGGAAGGCGGAGAGATGGGG - Intronic
1038049584 8:23796250-23796272 TCCTGGACAGCTCTGAAATGGGG + Intergenic
1038514630 8:28176298-28176320 TCCACGAAGGAAGTGAGATGGGG + Intronic
1040569236 8:48593037-48593059 TCAAGGATGGCTCTGAGGTTCGG + Intergenic
1041201234 8:55453215-55453237 TCCAGGAAGGCTGTGACCAGAGG + Intronic
1041394455 8:57376700-57376722 TCCAGGCAGGCTTTGATAAGTGG - Intergenic
1042007031 8:64192678-64192700 TGCTGGAAGGTTCTGAGTTGAGG - Intergenic
1042185787 8:66135198-66135220 CCCAGGAAGGCCCTAAGGTGTGG - Intronic
1043204222 8:77415983-77416005 TCTATGAAGGCTGAGAGATGTGG + Intergenic
1043372975 8:79613486-79613508 TCCAGAAAGGTTCTGAGAATGGG + Intronic
1046568497 8:115932047-115932069 TTCAGGAAGGCTCTGCTATATGG - Intergenic
1046674393 8:117092756-117092778 TCCAGGGAGACACTGAGATAAGG + Intronic
1047463450 8:125090880-125090902 TCCAGAAAAGTTCTGAAATGAGG + Intronic
1048199881 8:132363548-132363570 TCAAGGAAGGCTCATACATGCGG + Intronic
1048205535 8:132412397-132412419 TTCAGGATGGCTCTTAGGTGAGG + Intronic
1049361488 8:142214282-142214304 TCCAGGGAGGCCCTGTGGTGTGG - Intronic
1049396939 8:142405260-142405282 TCCAGGGAGGGGCAGAGATGAGG - Intergenic
1049941318 9:549222-549244 TACAGGAAGGTTCTGGGAGGGGG - Exonic
1051445363 9:17134728-17134750 TCAAGGAAGGCTTTAAGAGGTGG + Intergenic
1051896731 9:21995557-21995579 TCCAGAAAGGATCGGTGATGTGG - Intronic
1053453499 9:38212876-38212898 TCCAGGAAGGCCCAGAGACCAGG - Intergenic
1056702925 9:88925760-88925782 CCCAGGAAGGGTATGAGATGGGG - Intergenic
1057464395 9:95299449-95299471 TCCAAGAAGGCGGTTAGATGTGG - Intronic
1057864849 9:98671735-98671757 TCAAGGAAGGCTTTTAAATGGGG + Intronic
1059558934 9:115312207-115312229 TCTAGGAAGGCTGAGAGAGGTGG + Intronic
1059637555 9:116185708-116185730 TCCAGAAAGGCTAGGAAATGGGG + Intronic
1060213042 9:121722135-121722157 TCCAGGAAAGCTATGGAATGGGG + Intronic
1061534509 9:131239254-131239276 ACCAGGAAGGCTCTGCCGTGGGG - Intergenic
1061584764 9:131558499-131558521 CCCAGGAAGGCCTTGAGAGGAGG - Intergenic
1061758452 9:132832922-132832944 TCCAGGTCTGCTCTGAGCTGGGG + Intronic
1061807035 9:133142414-133142436 TGCAGGAAGGCTCCGGGCTGGGG - Intronic
1185780829 X:2843351-2843373 TCAGGTAAGGCTCAGAGATGCGG + Exonic
1186193292 X:7086996-7087018 CCCAGGAGGGCCCTGAGCTGGGG - Intronic
1187507472 X:19888428-19888450 CCCAGGAATCCGCTGAGATGAGG + Intergenic
1187655601 X:21468613-21468635 TCCAAGAAGGCTTGGAAATGTGG + Intronic
1188480343 X:30630667-30630689 TCCAGGAAGTCACAGAGATGGGG - Intergenic
1189035758 X:37492384-37492406 TCCAGGAAGTCGCAGAGCTGGGG - Intronic
1189037240 X:37505696-37505718 TCCAGGAAGTCACAGAGGTGGGG - Intronic
1189297624 X:39930003-39930025 TCCAGGAAGACTGACAGATGAGG - Intergenic
1191085743 X:56565155-56565177 TGCAGGAAGGCTGGGAGCTGTGG - Exonic
1191257606 X:58286391-58286413 TCCAGGAAGGCACTGACCTCTGG + Intergenic
1192090666 X:68152399-68152421 TGAAGAAAGGGTCTGAGATGTGG - Intronic
1199700277 X:150370719-150370741 ACCAGGGAGGCTCTGTGAAGGGG - Intronic
1201289245 Y:12406777-12406799 TCAGGTAAGGCTCAGAGATGTGG - Intergenic
1201565214 Y:15358440-15358462 TCCAGGAGGGCCCTGAGCTGGGG - Intergenic