ID: 1169825052

View in Genome Browser
Species Human (GRCh38)
Location 20:9758584-9758606
Sequence TGTCACAAAGTCATGGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169825052_1169825056 0 Left 1169825052 20:9758584-9758606 CCCACTACCATGACTTTGTGACA 0: 1
1: 0
2: 0
3: 14
4: 119
Right 1169825056 20:9758607-9758629 TTGCATTGGTAGCTTGAAATTGG 0: 1
1: 4
2: 28
3: 122
4: 393
1169825052_1169825057 6 Left 1169825052 20:9758584-9758606 CCCACTACCATGACTTTGTGACA 0: 1
1: 0
2: 0
3: 14
4: 119
Right 1169825057 20:9758613-9758635 TGGTAGCTTGAAATTGGCCATGG 0: 30
1: 127
2: 254
3: 392
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169825052 Original CRISPR TGTCACAAAGTCATGGTAGT GGG (reversed) Intronic
902446433 1:16468186-16468208 TGTACTAGAGTCATGGTAGTGGG - Intergenic
908710336 1:67007408-67007430 ACTCCCAAAGTCATGGTATTAGG - Intronic
909156967 1:72090736-72090758 TGTCCCAAATTCATGTGAGTAGG - Intronic
909665196 1:78124615-78124637 GGTCACAGAGTCATGTTAGAGGG - Intronic
911412248 1:97524402-97524424 AATCACAAAGTCATGGAATTAGG - Intronic
912095076 1:106129751-106129773 TGTCACTAAGCCATGGCAGTAGG - Intergenic
916235317 1:162581785-162581807 TGTGACAAAGTTATTGGAGTAGG + Intronic
921163038 1:212486444-212486466 TGGCACAAATTCCTGGTAGGAGG + Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
1063434519 10:6019528-6019550 TGTCCTAAAGTCACGGTAGCAGG - Intronic
1064980020 10:21157067-21157089 TGTCACAAAGTAAAGGTCCTGGG + Intronic
1065033993 10:21619131-21619153 TGTTATAAAGTGACGGTAGTAGG + Intronic
1065456625 10:25912900-25912922 TGATAGAAAGACATGGTAGTTGG - Intergenic
1066307629 10:34161997-34162019 TGAAACATAGTCATTGTAGTTGG + Intronic
1066610110 10:37236129-37236151 AGTTACAAAGTCAAGGAAGTAGG + Intronic
1071594781 10:86912344-86912366 AGTCACAAAGTTCTGGTAGTGGG + Exonic
1083061513 11:59877500-59877522 TGGCCCAATGTCATGCTAGTTGG + Intergenic
1083131827 11:60632271-60632293 TGTGCCAAAGGCATGGGAGTTGG + Intergenic
1085822321 11:79805992-79806014 TGTCACCAATCCATGGTGGTGGG - Intergenic
1087377029 11:97356204-97356226 TGTAACTAAGTCAAGTTAGTGGG + Intergenic
1089664523 11:120009697-120009719 TTAAACAAAGTCATGGGAGTAGG + Intergenic
1089834995 11:121362792-121362814 AGTCACAAAGTTCTGGTAGTGGG - Intergenic
1090601299 11:128374856-128374878 GGTCTCACAGTCATGGTAGAAGG + Intergenic
1091090772 11:132769396-132769418 AGTCACAAAGTCTTGTTTGTGGG - Intronic
1095039589 12:37426501-37426523 GGTCTCAGAGTCATGGTAGGAGG - Intergenic
1097449969 12:59725405-59725427 TGCCACAAAATCCTGGAAGTTGG - Intronic
1103396255 12:120609495-120609517 TTTCACAAAGTATTGGTAGAGGG - Intergenic
1105400365 13:20088021-20088043 TGGCAGAAATTCATGGTATTTGG - Exonic
1107367364 13:39697225-39697247 TGACACAATGCCATGGGAGTAGG + Intronic
1114259975 14:21029634-21029656 ACTCCCAAAGTCATGGTATTAGG + Intronic
1118055566 14:62076209-62076231 TGTCACAGAATCATGATAGGAGG - Intronic
1119724404 14:76913517-76913539 GGTCATAAAGTCAAGGTATTTGG - Intergenic
1124100279 15:26686638-26686660 TTTCACAAAGTTAAGGTAATAGG + Intronic
1125861352 15:43004023-43004045 TGTCACAATATCATGATAGGAGG + Intronic
1133102205 16:3486352-3486374 TGTCACAAAGCCATGGCAGAGGG + Exonic
1134357879 16:13501181-13501203 TGTCACAAATTGAGGGTAGGGGG + Intergenic
1144224237 17:13129226-13129248 TCTCACCAAGTCATGGTTTTAGG - Intergenic
1144745307 17:17609965-17609987 TGTCACAAAGGCCCAGTAGTGGG + Intergenic
1149543926 17:57489221-57489243 TTTCATAAACTCATGGAAGTGGG - Intronic
1153209528 18:2745343-2745365 AGTCACACAATCATGGTAGTAGG + Intronic
1155600326 18:27538698-27538720 TTTCAGAAAGTCAGGGGAGTGGG - Intergenic
1155719809 18:28997391-28997413 TTTGACAAAGTAATTGTAGTAGG - Intergenic
1157368424 18:47088003-47088025 GGGCACTGAGTCATGGTAGTGGG - Intronic
1159996752 18:74971918-74971940 GGTCTCATAGTCATGGTAGAGGG + Intronic
1160472306 18:79146763-79146785 ACTCACACAGTCATGGAAGTAGG - Intronic
925638312 2:5964058-5964080 TGTCTCACAATCATGGTAGAAGG + Intergenic
926965382 2:18404194-18404216 TAGTACAAATTCATGGTAGTGGG + Intergenic
927897946 2:26797175-26797197 TGTAACAAAGTCATGAGATTTGG + Intronic
931913658 2:66929658-66929680 TGTCACAAAATCATTCTAGTGGG - Intergenic
935804119 2:106729601-106729623 GGTCACACACTCATGGTGGTAGG - Intergenic
937755179 2:125528677-125528699 TGTCACCAAGTCATGGCCATTGG - Intergenic
938600996 2:132838734-132838756 TGGCACAAAGTCCCGGAAGTGGG + Intronic
940404998 2:153291368-153291390 TTTCACTAATTCATGGGAGTTGG + Intergenic
941756525 2:169192482-169192504 TGTCTCAAAGTCATAGAACTAGG + Intronic
942932510 2:181512690-181512712 TGTCTAAAGGTCATGGAAGTTGG + Intronic
945821756 2:214673531-214673553 TCTAACAAAGTCATGGAAGCAGG + Intergenic
945932580 2:215870284-215870306 TGTCCTCAAGTCATGGTAGCTGG - Intergenic
947092871 2:226532403-226532425 TTTCACAAGGTCAAGGTTGTAGG - Intergenic
947402782 2:229744997-229745019 GGTCACTGAGTCATGGGAGTGGG - Intergenic
947914726 2:233823740-233823762 TGTCTCCAAGGCATGGGAGTCGG + Intronic
948090924 2:235294631-235294653 AGTCACAAAATCATGTTAGTTGG + Intergenic
1169825052 20:9758584-9758606 TGTCACAAAGTCATGGTAGTGGG - Intronic
1171168710 20:22996114-22996136 AGTCACAAAGTCCTGGCAATGGG - Intergenic
1175067995 20:56306423-56306445 TATTACCAAGTCATGGGAGTTGG + Intergenic
1176173976 20:63709019-63709041 TATCACAACGCCATGGTGGTGGG + Exonic
1181814357 22:25426832-25426854 TGTCCCAAAGCCACCGTAGTCGG - Intergenic
1184237311 22:43189939-43189961 TTTCACAAAGTCATTGTATTGGG - Intergenic
949500780 3:4678166-4678188 TGTCTCAAAGTCATGTAATTAGG + Intronic
951464506 3:22987773-22987795 TGTCATAAATTCATATTAGTGGG - Intergenic
954124006 3:48518139-48518161 TGTCCCAAAGGCATGGTCCTTGG + Exonic
955430092 3:58834344-58834366 TGTCACATAGGTATGTTAGTTGG + Intronic
958038930 3:88203102-88203124 TGTCAAAAAGGCATGATAGGAGG + Intergenic
960900846 3:122552988-122553010 TAGCAAAAAGTCATGGTGGTCGG - Intronic
961941953 3:130647107-130647129 GGTCACAGAGCCATGTTAGTTGG + Intronic
962186685 3:133267807-133267829 TGTCACAAGGACATGTGAGTAGG - Intronic
962823758 3:139080172-139080194 TATCACAAAGTCATGGGATTGGG - Intronic
963570436 3:146988267-146988289 AGACACAAAGTAATGGGAGTAGG + Intergenic
963734230 3:149001876-149001898 TGTCATAAAGCCAAGGTAATAGG - Intronic
965699594 3:171446517-171446539 TGACACAACTTTATGGTAGTTGG - Intronic
967297291 3:187977782-187977804 TCTCAAAAAATCATGGTGGTGGG + Intergenic
967299028 3:187994046-187994068 TGACCCAAAGTCATGGGGGTTGG + Intergenic
967306738 3:188066802-188066824 AGTCACAAAGTCAAAGTAGCAGG + Intergenic
967800218 3:193649883-193649905 TGACACAAAGCCATGGAACTGGG - Intronic
971112220 4:23600412-23600434 TGTCACAAATGCATAGCAGTGGG + Intergenic
972707802 4:41562439-41562461 TGTCAATAAGTATTGGTAGTAGG + Intronic
974304618 4:60117631-60117653 TCTTACAAGGTGATGGTAGTAGG - Intergenic
974405225 4:61459726-61459748 TTTGATAAAGTCATGGTAATTGG + Intronic
974991567 4:69097312-69097334 AGCCATAAAGTCAGGGTAGTGGG + Intronic
975021402 4:69495048-69495070 AGCCATAAAGTCAGGGTAGTGGG - Intronic
975691741 4:76972022-76972044 CCTCACTAAGTCATGGTAGTTGG - Intronic
976985561 4:91291919-91291941 TATCACAAAGTCTTGGATGTTGG - Intronic
980731968 4:136835479-136835501 ACCCACAAAGTGATGGTAGTAGG + Intergenic
982820335 4:159936673-159936695 AATCACAAAGTCACGGAAGTCGG - Intergenic
983376511 4:166935240-166935262 TATCTCAAACTCATGGTTGTTGG - Intronic
984921618 4:184769221-184769243 TGTCACAAATTCATCATACTTGG - Intronic
985606139 5:859026-859048 CCTCACAAAGCCATGGCAGTTGG + Intronic
986865926 5:11987049-11987071 TTTCACAAAATCATGATAATTGG - Intergenic
998088220 5:139344188-139344210 TGTCACAGAGCTATGATAGTCGG + Intronic
1000288584 5:159848714-159848736 TGGAACAAAGTCATGGGACTTGG + Intergenic
1003629333 6:7772564-7772586 TGGCAGAAAGGCATGGTACTCGG - Intronic
1007653825 6:43439880-43439902 TGTTAAAAAGACAGGGTAGTAGG - Intronic
1009841709 6:69085201-69085223 TCTCAGAAAGTCATTGAAGTCGG + Intronic
1010574966 6:77518930-77518952 CACCACAAAGTCATGGTAGCCGG + Intergenic
1011814033 6:91167373-91167395 TTTCATAAAGTCATGCTATTTGG - Intergenic
1012668300 6:102007440-102007462 TGTCACAAAGTGAAGGTGGCAGG - Intronic
1013677100 6:112477202-112477224 TGTCACAAAATCTTTGAAGTTGG - Intergenic
1015076008 6:129158465-129158487 AGTCACAAAGTTCTGGTAGTGGG - Intronic
1015386109 6:132625475-132625497 TGTCTCCATGTCATGGCAGTCGG + Intergenic
1019781792 7:2944795-2944817 TTTCACAAAGTAAAGGTAGATGG + Intronic
1020730638 7:11874677-11874699 TGCTACAAAGTCATGGTAATTGG + Intergenic
1021445994 7:20734153-20734175 TGTGACACATTCATGGTAGTTGG - Intronic
1026497901 7:70919450-70919472 GGTGGCAAAGTCATGGGAGTGGG + Intergenic
1027451702 7:78339034-78339056 TGGCACAAAGTCAGGAGAGTAGG - Intronic
1028331218 7:89594482-89594504 TAACACAAAGGAATGGTAGTGGG - Intergenic
1039139671 8:34372476-34372498 TGTCCCTAAGTCATGGTCTTTGG + Intergenic
1039596692 8:38796897-38796919 TCTCACATAGTCTTTGTAGTTGG + Intronic
1041782033 8:61587315-61587337 TGACACAGATTGATGGTAGTAGG + Intronic
1042248522 8:66732296-66732318 TTTCACAAACTCATGGTTGATGG - Intronic
1043861262 8:85319907-85319929 TCTTACAAAGTCAAGGTAGATGG + Intergenic
1044865632 8:96568471-96568493 TGCCAGACAGGCATGGTAGTTGG + Intronic
1048730448 8:137434434-137434456 TATCACAAAGTCACGAAAGTGGG - Intergenic
1050968251 9:11835752-11835774 TGTCAGAAAGTTACAGTAGTAGG + Intergenic
1052809811 9:33047538-33047560 TGTCACAATGTGATGTGAGTTGG - Intronic
1053334151 9:37249185-37249207 TGTGACAATATCTTGGTAGTGGG + Intronic
1055539991 9:77293105-77293127 GGTCATAAAATCAAGGTAGTAGG - Intronic
1056029023 9:82531949-82531971 TGGCATAAAGTCAAGTTAGTTGG + Intergenic
1056786799 9:89598309-89598331 TGTCCCAATGTCATGGTTGCAGG - Intergenic
1186966689 X:14794732-14794754 AGTCACACAGTCATTGCAGTAGG + Intergenic
1188593602 X:31869546-31869568 TGTCACCAAGTCAGGATGGTGGG - Intronic
1192443258 X:71190850-71190872 TGTCACCAAGTCAGGGGGGTGGG - Intergenic
1194560474 X:95412823-95412845 TGCCTCAAAGTCATGGCAGAAGG - Intergenic
1195109014 X:101626745-101626767 TGTGAGAAAGGCATGGAAGTAGG + Exonic
1195293420 X:103451135-103451157 TGTGACAAGGTCATGTTAGTGGG + Intergenic
1201704491 Y:16921203-16921225 GGTCTCACAGTCATGGTGGTAGG + Intergenic