ID: 1169825974

View in Genome Browser
Species Human (GRCh38)
Location 20:9769076-9769098
Sequence CTGTGTTCTCACTGTGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169825974_1169825975 -6 Left 1169825974 20:9769076-9769098 CCTTTAACACAGTGAGAACACAG 0: 1
1: 0
2: 1
3: 20
4: 345
Right 1169825975 20:9769093-9769115 ACACAGAGTTCTAACTTACTAGG 0: 1
1: 1
2: 1
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169825974 Original CRISPR CTGTGTTCTCACTGTGTTAA AGG (reversed) Intronic
901367034 1:8761453-8761475 CTGTGTTCCCAATTTTTTAATGG + Intronic
902469987 1:16642638-16642660 CTCTGTTCTCACTGTGCTCCTGG - Intergenic
902938335 1:19780899-19780921 GTGTGTTCTCACTCTCCTAAAGG - Intronic
903316548 1:22512414-22512436 TTGTGTGCTCACTCTGTTACAGG - Intronic
904051592 1:27642837-27642859 CCATGTTCTCACAGTGTGAAAGG + Intergenic
907591755 1:55680555-55680577 TTGTCTTTTCACTGTCTTAACGG + Intergenic
908032754 1:60019125-60019147 CTGTATTCTCCATGTGTTGAAGG + Intronic
908755446 1:67465202-67465224 GTGTGTGCTCACAGTGTTTATGG + Intergenic
910513473 1:88033405-88033427 CTGTCTTTTCACTTTATTAATGG - Intergenic
911061388 1:93751138-93751160 CAGTTTCCTCACTGTGTGAAGGG - Intronic
911887630 1:103324919-103324941 ATGGGGTTTCACTGTGTTAACGG + Intergenic
912759225 1:112351907-112351929 CAGTGTTCTCTCTGTATTATGGG + Intergenic
913994545 1:143641125-143641147 TTGTGTTTTCACTCTTTTAATGG - Intergenic
916017183 1:160760462-160760484 CTGTGTTCTCACATGGTGAAAGG - Intergenic
917505052 1:175619831-175619853 CTGTGTTTGCACTGTTTTAGTGG - Intronic
919720088 1:200824568-200824590 CTGAGTTCTCACTGTGGAAGGGG - Intronic
920453366 1:206077816-206077838 TTGTTTTCTCACCGTATTAAGGG + Intronic
923026771 1:230210700-230210722 CTATGTTTTGGCTGTGTTAAAGG - Intronic
923122149 1:231002098-231002120 GTGAGTTCTCAATGTGTGAAAGG + Intergenic
923538426 1:234870810-234870832 CTGAGTTCTCACTGTCCTCAAGG + Intergenic
924604373 1:245520262-245520284 CTGTGTTCTCTATGAGTTAAAGG - Intronic
1063919684 10:10920373-10920395 CAGTATTCTTACTGTGTTCAGGG + Intergenic
1067980548 10:51079479-51079501 CTGTGCTGTCACTTTGCTAATGG - Intronic
1068154028 10:53172379-53172401 CTGTGCTCTCAATGTCTCAATGG - Intergenic
1068683560 10:59845842-59845864 CTTGGTTCTCCCTGTGTTAGGGG - Intronic
1069207980 10:65716924-65716946 GTGTGTTCCCACTCTATTAATGG - Intergenic
1070103488 10:73411209-73411231 GTATGTTCTCACTGTGTAAGTGG + Intronic
1070377038 10:75842830-75842852 CAGGGGTCTCACTGTGTTACTGG - Intronic
1072516417 10:96187808-96187830 CTGTGATCTCAATGTCTCAATGG - Intronic
1073931453 10:108581464-108581486 CTGTGTTCCCGCTGTGTGCAAGG + Intergenic
1074982050 10:118627511-118627533 ATGAGTGCTCACTGTGCTAATGG - Intergenic
1075019325 10:118938830-118938852 CTGTCTTCTCACTTTCTTGATGG - Intergenic
1076620270 10:131782752-131782774 CTGTGTTCTCAGTGTCCTCACGG - Intergenic
1077001108 11:322749-322771 TTTTCTTCTCCCTGTGTTAAGGG + Intronic
1077847737 11:6043791-6043813 CTGTCTTCTCACTGGGCTCATGG + Intergenic
1078186001 11:9052697-9052719 CTGGGGGCTCACTGTGTTCAAGG - Intronic
1078926146 11:15876847-15876869 CTGTGTTCTTACTGTGTCATTGG - Intergenic
1079634120 11:22713924-22713946 TTGTTTTCTCATTGTGTTATTGG - Intronic
1080025050 11:27604617-27604639 CTGTGTTCTCACATGGTGAAAGG - Intergenic
1081069486 11:38593643-38593665 CTGTGTCCTCACAAGGTTAAAGG + Intergenic
1082765236 11:57162563-57162585 ACATGTTCTCACTGTGATAATGG - Intergenic
1083057476 11:59836789-59836811 CTGTCTTCTGACTTTGTGAAAGG + Intronic
1084439261 11:69162041-69162063 CTATGTTCTCACAGTTTTGAAGG - Intergenic
1085145635 11:74193124-74193146 ATGTTTTTTCACTGTATTAATGG + Intronic
1086016633 11:82175747-82175769 TTGTGTTATTACTGTTTTAATGG - Intergenic
1086078103 11:82876136-82876158 CTGTGCTGTCACTGTTTTGAAGG + Intronic
1089825455 11:121271832-121271854 CTGTGTTCTCACATGGTAAAAGG + Intergenic
1090131808 11:124150554-124150576 CTGTGTTCTCAGTTTCTAAAGGG + Intergenic
1091768264 12:3135954-3135976 CTGGGTTTTCAGTGTCTTAAAGG + Intronic
1092514902 12:9200743-9200765 CTGTGTTCACACCGTCCTAATGG + Intronic
1092856299 12:12676855-12676877 CTGTGTGCTCATTGAGTTAGTGG + Intronic
1093624678 12:21331212-21331234 CTTTGTTCTGAGTGTTTTAAGGG + Intronic
1094695224 12:32811196-32811218 TTGTGTCCTCACTGTTTTCAAGG - Intronic
1095301142 12:40585575-40585597 CTGTGTCCTCACTTAGTTTAAGG + Intergenic
1097375522 12:58838583-58838605 CTTTGTTCTCATTGGTTTAAAGG + Intergenic
1098680461 12:73347567-73347589 CTTTATTCTCACTGTTTTCAGGG + Intergenic
1098729507 12:74015187-74015209 CTTTTCTCTCACTCTGTTAAAGG - Intergenic
1099368815 12:81804264-81804286 TTATTTTCTCACTGTATTAATGG - Intergenic
1099617924 12:84962538-84962560 CTGTTTTCTCATTGTGCTCATGG + Intergenic
1100649985 12:96575333-96575355 CTGTCTTTTCACTTTCTTAATGG + Intronic
1103074590 12:117971874-117971896 CTGTCTTCTCCCTGGGATAATGG + Intergenic
1104094265 12:125542189-125542211 CTGTTTTCTCTCTGGGTTAGAGG - Intronic
1104174183 12:126313485-126313507 CTGTGTTCTTGCTGTCTCAAGGG + Intergenic
1104195081 12:126529192-126529214 CTGAGTTCTCACTGTGTTCTTGG - Intergenic
1105505544 13:21006373-21006395 CTGTCTGCTCACTTTTTTAAGGG - Intronic
1105616413 13:22018057-22018079 TTGTGTTCTCTCTATGTTCAAGG + Intergenic
1107303883 13:38996962-38996984 TTATTTTTTCACTGTGTTAACGG - Intergenic
1107819299 13:44271915-44271937 CCTTGTTCTCACTGTTTTACTGG + Intergenic
1108281460 13:48866294-48866316 CTGTGTTCTCACATGGTTGAGGG - Intergenic
1108296330 13:49021726-49021748 CTGTGTTCTCACTGCTGTTATGG + Intronic
1108982534 13:56536755-56536777 GTATATTTTCACTGTGTTAATGG + Intergenic
1109018782 13:57056911-57056933 CTTTGTTAGCACTTTGTTAAAGG + Intergenic
1110836647 13:80091308-80091330 CTTTGTTCTCACTGGTTTCAAGG + Intergenic
1111450773 13:88412408-88412430 TTGTGTTTTCATTTTGTTAATGG + Intergenic
1112225429 13:97535087-97535109 CTGTGTTCTCATTGTATTCCGGG + Intergenic
1113024231 13:105922667-105922689 CTGTGTTCTCCCAGTGTGAAAGG - Intergenic
1113248615 13:108426806-108426828 CTGTGTTGTCACCTTGTTTATGG + Intergenic
1113568357 13:111335104-111335126 CAGTGTTCTCATTGTTTTTATGG + Intronic
1114065760 14:19058972-19058994 GTCTTTGCTCACTGTGTTAAAGG - Intergenic
1114096501 14:19341028-19341050 GTCTTTGCTCACTGTGTTAAAGG + Intergenic
1114724235 14:24917790-24917812 TTGTCTTCTCACTTTATTAATGG - Intronic
1114803811 14:25810016-25810038 CTGTGTTCTTTATCTGTTAATGG - Intergenic
1115229147 14:31139390-31139412 CTGTGTTCTCACATTGTAGAAGG - Intronic
1115416151 14:33136433-33136455 CTGCATTATCAATGTGTTAAAGG - Intronic
1115577020 14:34721596-34721618 CTGTCTTTTCACTTTCTTAATGG + Intergenic
1116937105 14:50751991-50752013 CTGTCTTCTAACTTTGTTTATGG + Intronic
1117146871 14:52844755-52844777 CCGTGTTCTCACATTGTTACGGG + Intergenic
1117309664 14:54509364-54509386 TTGTGTTTTCACTGTGCTTATGG + Intergenic
1117406944 14:55412860-55412882 CTGTTTTCTTACTTTGGTAAAGG + Intergenic
1118790659 14:69089224-69089246 TTGTGTTCTCACTGTGTGCCAGG + Intronic
1119640748 14:76313016-76313038 CTGTGTTCTCAGAGCCTTAATGG + Intronic
1121727737 14:96165566-96165588 GTGTGTGCTCTCTCTGTTAAGGG + Intergenic
1121936815 14:98027520-98027542 CTGTGTGGTCACTGAGGTAATGG + Intergenic
1122005435 14:98699536-98699558 CCTTGTTCTCACTATGTTTATGG + Intergenic
1122154531 14:99742304-99742326 CTGGGTTTTCACTGGGTTTATGG + Intronic
1122674903 14:103404423-103404445 CTGTGTACACACTGTGTACATGG - Intronic
1123166869 14:106334080-106334102 CTAGGTTCTTACAGTGTTAAAGG - Intergenic
1123169487 14:106358791-106358813 CTAGGTTCTTACAGTGTTAAAGG - Intergenic
1124082437 15:26514191-26514213 CTGTGTTCTCAGTGTTTCAGAGG - Intergenic
1124210278 15:27757731-27757753 CACTGTTCTCACTGTTCTAAGGG - Intronic
1124874470 15:33578977-33578999 TTGTATTCTCTCTGTGTTGAAGG + Intronic
1127534565 15:59878077-59878099 CTGTGCACTGAATGTGTTAAAGG + Intergenic
1128486252 15:68092729-68092751 CTGTGTCCTCACAGGGTGAAAGG - Intronic
1128578229 15:68790643-68790665 GTGTGTTCTCTCCGTTTTAAAGG + Intronic
1130015483 15:80182929-80182951 CTCTGTTGTCAGTGTGATAAGGG + Intronic
1131263405 15:90901988-90902010 CTGTGTTCTCACGTGGTTGAAGG + Intergenic
1131310936 15:91289364-91289386 CTGTGCTCTCTCTGTGTGGAGGG + Intronic
1132386446 15:101404114-101404136 TGGTCTTCTCACTGTGTTTATGG + Intronic
1133438348 16:5799646-5799668 ATGTGTTCTGAGTGTGTTCAAGG + Intergenic
1133663713 16:7944445-7944467 CTGTGTTCTCACATGGTGAAAGG - Intergenic
1138330283 16:56208929-56208951 TTGTCTTTTCACTTTGTTAATGG + Intronic
1140733330 16:77875878-77875900 CAGTGTTCTCCCTGTCTTCATGG - Intronic
1140942914 16:79738624-79738646 GTCTGTTCTCACTGTTATAAAGG - Intergenic
1140990091 16:80202357-80202379 CTTTGTTCTCAATGTGTTCTGGG - Intergenic
1141377413 16:83544481-83544503 AAGTGTTCTCAGTGTGTTTAAGG - Intronic
1141786983 16:86207615-86207637 CTGTGATGTCACTGGGGTAATGG - Intergenic
1142102408 16:88282289-88282311 CTGTGTTCTCACTGTGTTCCAGG + Intergenic
1142923507 17:3212219-3212241 CTGTGGTCACACTGTATCAAGGG + Intergenic
1143744830 17:8984906-8984928 CAGTGTTCTCACTGCTTTTATGG - Intergenic
1148292325 17:46464776-46464798 CTATTTTTTCACTGTATTAATGG - Intergenic
1148314509 17:46682468-46682490 CTATTTTTTCACTGTATTAATGG - Intronic
1149121053 17:53165496-53165518 CTGTATTCTGACTGTGATAGTGG + Intergenic
1150381926 17:64727665-64727687 CTGTGTTCTCATTGTGGGGATGG + Intergenic
1151444638 17:74155242-74155264 CTCTGTTCTCACTGTGTTCTGGG - Intergenic
1152412991 17:80139231-80139253 CAGTGTTCCCACTGGGTTAGAGG + Intronic
1153201824 18:2655458-2655480 CTGTGTTCTCTCTGTGGAAAGGG - Intergenic
1153599748 18:6768769-6768791 CTGGGGTCTCACTGAGTTAAGGG - Intronic
1156100096 18:33583202-33583224 ACATTTTCTCACTGTGTTAATGG + Intronic
1156686897 18:39660916-39660938 CAGTATTCTCACTGTGTTTCTGG + Intergenic
1156729562 18:40175162-40175184 CTGTGTTCTCACACAGTGAAAGG + Intergenic
1156761287 18:40594287-40594309 CTGTGTTCTCACACGGTGAAAGG - Intergenic
1158745661 18:60196784-60196806 CTGTGTTTTCACTGGGAAAACGG - Intergenic
1158847881 18:61463765-61463787 CTGTGTCCTCACTCTGTCCAGGG + Intronic
1158881696 18:61784954-61784976 CTGTGTGCACAGTGTGTTCAAGG - Intergenic
1158892868 18:61889397-61889419 CTTTGTTCACATTGTGATAACGG - Intronic
1159432756 18:68376785-68376807 CTGTATTCTGACTTTGTGAAAGG - Intergenic
1159801789 18:72909376-72909398 CATTATTCTCACTGTTTTAATGG + Intergenic
1159881275 18:73860744-73860766 CTGTGGTCTCACTGTGGGGATGG - Intergenic
1161589443 19:5122629-5122651 TTGTCTTCTCACTTTCTTAAAGG - Intronic
1162043272 19:7983224-7983246 CTGGGTTCTCACTTTGTCCAGGG - Intronic
1164979601 19:32603900-32603922 CTGTGTTCACACTGTGAGGATGG + Intronic
1165607132 19:37115357-37115379 CTGAGTTCTCTCAGTGTTTATGG + Intronic
1166138691 19:40793598-40793620 ATATGGTCTCACTGTGTTAGCGG + Intronic
926110348 2:10178879-10178901 CTGTGTCCTCACGTGGTTAAAGG - Intronic
926414443 2:12635144-12635166 CTGTTTGCTCACTGTGTTCCAGG - Intergenic
926586997 2:14697538-14697560 CAGTGTTCTCAGAGTGTTACAGG - Intergenic
927263694 2:21120681-21120703 TTGTCTTTTCACTTTGTTAATGG + Intergenic
928619951 2:33078493-33078515 CTGTGTTTTTACTGTGTGAGAGG + Intronic
928771485 2:34707208-34707230 CTGTGTTCTCACATGGCTAAAGG - Intergenic
929256705 2:39818921-39818943 CTGTGTTCTCACATGGTGAAAGG + Intergenic
929433721 2:41910338-41910360 CTATGTTCTCACTGTGTAGGAGG - Intergenic
929507740 2:42541554-42541576 ATGTGTTCTGAGTGTGTTTAAGG + Intronic
930557677 2:52919812-52919834 CTGTGTTCTCACAGAGTGGAAGG - Intergenic
935483980 2:103629859-103629881 CTGTGTCCTCACAGTGTGGAAGG - Intergenic
935871092 2:107450811-107450833 TTGTCTTCTCAGTGTGTTAAGGG - Intergenic
935923917 2:108046534-108046556 CTGTGTTCTCATTGTGGTGGAGG + Intergenic
937054545 2:118922513-118922535 TTGTGTACTCACTGTTTTCAAGG + Intergenic
938483162 2:131679101-131679123 GTCTTTGCTCACTGTGTTAAAGG - Intergenic
938794486 2:134706387-134706409 CTGAGTTTCCACTGTGTTAGCGG + Intronic
938946055 2:136212962-136212984 CTGTGTTCTCACTTGGTAGAAGG + Intergenic
939159735 2:138573858-138573880 CAGTGTTCTCAAAGTATTAAGGG - Intergenic
939162159 2:138603622-138603644 CTGTGTTCTCACAGGGTTGAAGG + Intergenic
939677464 2:145090240-145090262 CTGTGTCCTCACATGGTTAAAGG - Intergenic
939980720 2:148777439-148777461 CTGTGTTCCTACTCTGTTATGGG + Intronic
941385794 2:164850058-164850080 TTGTTTTCTGACCGTGTTAAAGG + Intergenic
942336479 2:174892394-174892416 CTGTGTTCTCACATTGTGAAAGG - Intronic
944580479 2:201127806-201127828 CTGTCTTCCCTCTGTGCTAACGG - Intronic
945832088 2:214799699-214799721 CTGTGTTTTTTCTGTGTCAAAGG - Intronic
946536089 2:220630403-220630425 CTGTGACCTCGCTGTGTGAACGG + Intergenic
947652261 2:231796915-231796937 TTGTGTTTTCTCTGTTTTAATGG + Intronic
948261302 2:236606311-236606333 CTGTCTTCCCACCGTGTGAACGG + Intergenic
948683459 2:239654455-239654477 ATATTTTCTCACTGTGTTAATGG - Intergenic
948688103 2:239683973-239683995 CAGAGTTCTCAATGTTTTAAGGG + Intergenic
1168770613 20:412736-412758 TTGTCTTCTCACTTTGTTGATGG + Intronic
1169825974 20:9769076-9769098 CTGTGTTCTCACTGTGTTAAAGG - Intronic
1170570330 20:17628886-17628908 CTCTGTTCACTCGGTGTTAATGG + Intronic
1171073715 20:22101447-22101469 CTGTGTTCTCACTGAGAACAGGG - Intergenic
1171217579 20:23363011-23363033 CAGTGTTCTCACAGTTTTACTGG + Intronic
1171453068 20:25249164-25249186 CTGTGTTCTTGCTGTGTTTTTGG + Intronic
1173641622 20:44606862-44606884 CTGTGTTCTCACAGAGCAAATGG - Intronic
1173663976 20:44752509-44752531 CTGAGGTCCCACTGTGTTAGTGG - Intronic
1174707524 20:52671568-52671590 CTGTGTTCTGACTGTGTCCAGGG + Intergenic
1177726585 21:24976202-24976224 CTGTGTTTTCACTTTCTTGATGG - Intergenic
1178924904 21:36766740-36766762 CTCTGTGGTCACTGTGTGAATGG + Intronic
1179420733 21:41234325-41234347 CTGTTTTTACACTGTGATAAAGG - Intronic
1180484242 22:15781564-15781586 GTCTTTGCTCACTGTGTTAAAGG - Intergenic
1182621518 22:31621169-31621191 CTGGGTGCTCACTGTGTTGGTGG - Intronic
1182696131 22:32200424-32200446 CTGGGTTCTCAGTGTGTGTAAGG + Intronic
1184722810 22:46325149-46325171 CTCTGTCCTCACTGGGTTAGGGG + Intronic
1184815730 22:46868115-46868137 CAGTTTTTTCACTGTATTAATGG + Intronic
949904226 3:8844976-8844998 CTGTGTTCTCACATGGTGAAAGG - Intronic
952311244 3:32192447-32192469 CTGGGTTCTCACTGGGTTCTGGG - Intergenic
954299445 3:49691616-49691638 CTCTGTTCTCACTGTGCTCCTGG + Intronic
955159693 3:56452242-56452264 ATGTGTTCTCACTGGGTGAAAGG + Intronic
955441943 3:58965948-58965970 CAGTGTTCTCACTGCTTTTATGG - Intronic
955725914 3:61932535-61932557 CTGAGTTCTTACTGTGTGCAAGG + Intronic
956314618 3:67920275-67920297 TTGTGTTCACACTTTATTAAGGG - Intergenic
957150850 3:76484439-76484461 CTGTGGACTCACTGAGTTTAAGG - Intronic
958455239 3:94322913-94322935 CTGTGTCCTCACTGTTTCCAAGG - Intergenic
958584648 3:96070376-96070398 TTGTGATCTCACTGTGTTGCAGG - Intergenic
958748259 3:98163857-98163879 CTGTGTTCTCACGTGGTGAAAGG + Intergenic
958752046 3:98203198-98203220 CTGTGTTCTCACGTGGTGAAAGG + Intergenic
960259245 3:115546679-115546701 CTTTTTTCTCTCTGTTTTAATGG + Intergenic
960927457 3:122809055-122809077 CTGTGTTCCCCATCTGTTAATGG - Intronic
960940440 3:122929650-122929672 GTGTGTTCCCACAGTCTTAAGGG + Intronic
961740208 3:129028495-129028517 CTGTGTTCTCACAGTTTTGTTGG - Intronic
963185135 3:142407012-142407034 TTGCGTTCTCACTGTTTTCAAGG - Intronic
963220103 3:142800058-142800080 CTGTATTCTTACTGTCATAAGGG + Intronic
963369209 3:144376767-144376789 TTGTTTTTTCACTGTATTAATGG - Intergenic
964462974 3:156956878-156956900 ATGTGTTTTTCCTGTGTTAATGG - Intronic
964502519 3:157364227-157364249 CTTTGTTATCACTCTGTTATGGG - Intronic
964681979 3:159351442-159351464 CTGTGTTTTCAATGAGTTAGGGG + Intronic
965085738 3:164095150-164095172 CTGTGTACTTACTGTGTGCAAGG + Intergenic
965941388 3:174186771-174186793 CTGTGTTCTAAGTGCTTTAAAGG + Intronic
966532139 3:180992923-180992945 CTGTGTTCTCACAGGGTGGAAGG - Intergenic
967746991 3:193067754-193067776 CTGTGATCTCACTGTTTCATAGG + Intergenic
970905936 4:21216305-21216327 ATGTGTCCTCACTGTGTACATGG + Intronic
971289691 4:25325557-25325579 CTGTCTTTTCACTTTCTTAATGG + Intronic
971759262 4:30744128-30744150 CTGTTTTCTCACTGTCTCAGAGG + Intronic
972049999 4:34718739-34718761 CTGTGTTCTCTCAGTGTTTCTGG + Intergenic
973861995 4:55074881-55074903 CTTTGTTCTTATTGTGCTAAAGG + Intergenic
974365763 4:60946934-60946956 CTGTGTTCTCACATGGTGAAAGG + Intergenic
975557401 4:75677990-75678012 CTGTGTTCTCACATGGTGAAAGG - Intronic
976547355 4:86351828-86351850 TTGAGTTCTCACTGTGTAATAGG - Intronic
976700106 4:87960373-87960395 CTGTGTTCTCACTTGGTATAAGG + Intergenic
977493662 4:97746265-97746287 CTGTGTTTTTAATGTTTTAATGG - Intronic
978116932 4:105030609-105030631 CTTTGTTCTCACTGGTTTCAAGG - Intergenic
978930910 4:114310712-114310734 CTGTGTTCTGACTGACTTAGAGG + Intergenic
979059357 4:116037165-116037187 CTGTTTGCTCACTCTGTTGATGG - Intergenic
979185332 4:117783564-117783586 CTGTGTTTCAAATGTGTTAATGG - Intergenic
981353872 4:143764813-143764835 CTGTGTCCTCACATTGTGAAAGG - Intergenic
982280563 4:153680253-153680275 CTGTCTTCTCACTGTGTTCTTGG + Intergenic
982388978 4:154843397-154843419 CTCTGTTCTCAATGTAGTAAAGG - Intergenic
982825505 4:159999450-159999472 CTGTGGTATCACTGAGTTGAGGG + Intergenic
983117665 4:163838945-163838967 TTGTCTTTTCACTTTGTTAATGG - Intronic
983195325 4:164799993-164800015 CTGTTTTCTAAATGTTTTAAAGG - Intergenic
983320269 4:166188127-166188149 TTGTGTTCTGACTATGTTTATGG - Intergenic
984334565 4:178373611-178373633 CTGAATGTTCACTGTGTTAAAGG - Intergenic
984338604 4:178424518-178424540 CTGTGTTCTCACATAGTAAAAGG + Intergenic
984905456 4:184621811-184621833 CTGTCTTCTCACTTGGTTCATGG + Intergenic
985293320 4:188408064-188408086 CTGTCTTCTAATTGTTTTAAAGG + Intergenic
985773557 5:1827877-1827899 CTGTGTCCTCACTTTGTGGAAGG - Intergenic
986045166 5:4029803-4029825 ATCTGTTATAACTGTGTTAAGGG + Intergenic
986179741 5:5382565-5382587 CCGTGTACTCACAGTGTTAATGG - Intergenic
986689090 5:10299123-10299145 TTGTTTTCTCACTTTGTTTATGG - Intronic
987760776 5:22160710-22160732 CTGTGTTCTCACATGGTGAAAGG + Intronic
988173540 5:27690892-27690914 CTGTGTCCTCACAGGGTGAAAGG + Intergenic
988482988 5:31645247-31645269 CTGGGGCATCACTGTGTTAAGGG - Intronic
989591372 5:43116178-43116200 CTGTGTTATTACTGTGTCCAGGG + Intronic
990240419 5:53811279-53811301 ATGTGATCTTACTGGGTTAAGGG - Intergenic
991895553 5:71394163-71394185 CTGTGTTCTCACATGGTGAAAGG + Intergenic
992252011 5:74885378-74885400 CTTTGATCTCCCTGTGGTAAAGG + Intergenic
992422005 5:76615704-76615726 CTGTCTAATCACTGAGTTAAGGG + Exonic
993779804 5:92052358-92052380 TTGTGTCCTCTTTGTGTTAAAGG - Intergenic
994699030 5:103110283-103110305 CTATGTTTTCACTTTCTTAATGG - Intronic
995351472 5:111181071-111181093 CTGTGTTCCCCCTCTGTGAATGG + Intergenic
995399234 5:111721601-111721623 ATGTAATCTCAGTGTGTTAAAGG + Intronic
996480515 5:123970469-123970491 CTGTGTTCTCACATGGTGAAAGG + Intergenic
996742474 5:126813686-126813708 CTGTGTCCTCACATGGTTAAAGG + Intronic
997922930 5:137999802-137999824 CTGTGTTACCACTGAGTGAAAGG + Intronic
998452143 5:142243003-142243025 TTATTTTCTCACTGTCTTAAAGG + Intergenic
998998792 5:147896393-147896415 CTGTGTTCTTACTCTGTTTTAGG - Intronic
1000678696 5:164156615-164156637 CCCTGTTCTCACAATGTTAAGGG - Intergenic
1000773088 5:165381695-165381717 TTGTGTTTTCACTTTCTTAATGG + Intergenic
1004164036 6:13239994-13240016 TTGTGTTCCCACTGGGTAAAAGG - Intronic
1005170069 6:22973802-22973824 TTGTGTCCTCACTGTTTTCAAGG + Intergenic
1005172209 6:23000930-23000952 CTGTTTGTTCACTGTTTTAATGG - Intergenic
1006213963 6:32422888-32422910 CTTTGTTCTCACTGCCTGAAAGG + Intergenic
1008438096 6:51499573-51499595 CTGTGTTCTCACTTGGTGGAAGG + Intergenic
1009040612 6:58171830-58171852 CTGTGTTCTCACATGGTGAAAGG - Intergenic
1009993614 6:70875093-70875115 CAGTGTTCTCACTGTTTTTATGG + Intronic
1010025994 6:71217797-71217819 CTGTCTTCTCTCTGTGTTGATGG - Intergenic
1010485828 6:76412651-76412673 CTAGGTACTCACAGTGTTAAGGG + Intergenic
1011400235 6:86953447-86953469 CTGTGTTCTCACATTTCTAAGGG + Intronic
1011879060 6:92000542-92000564 CTGTGTCCTCACTGTTTTCAAGG + Intergenic
1011984794 6:93430069-93430091 TTGTCTTTTCACTATGTTAATGG + Intergenic
1012029705 6:94042856-94042878 CTATGTTCTCAGTGTTTTTATGG + Intergenic
1012272685 6:97234172-97234194 CTGTTATCTGAATGTGTTAATGG - Intronic
1012652647 6:101776017-101776039 TTGTGTTTTCACTGTGTAAGAGG + Intronic
1012879228 6:104765309-104765331 CTGTGTTCTCAATCTCTTCAAGG - Intronic
1013446859 6:110238021-110238043 CTGTGTCCTCACATTGTAAAAGG + Intronic
1014083814 6:117318298-117318320 CTGTGAGCTCAGTGGGTTAATGG + Intronic
1014375589 6:120668474-120668496 TTGTCTTTTCACTCTGTTAATGG + Intergenic
1017307044 6:152930703-152930725 TTGTGTTTTCACTATGTTGATGG - Intergenic
1017636296 6:156446483-156446505 CTTTGTTTTCTCTGGGTTAAGGG - Intergenic
1017827697 6:158094352-158094374 ATGTGTTCTGAGTGTGTTCAAGG - Intronic
1017890546 6:158634874-158634896 CTGTGTTTTTCCTGTGATAAAGG - Exonic
1018295933 6:162343991-162344013 CTCTGTCATCACTGTGGTAAAGG - Intronic
1019035111 6:169048074-169048096 GTGTTTTCTCACTGTGTGATGGG + Intergenic
1020688603 7:11326888-11326910 CTGTGTCCTCACATTGTCAAAGG - Intergenic
1020993162 7:15227960-15227982 CAGTATTCTTACTGTGTAAAAGG - Intronic
1021142203 7:17040328-17040350 CTGTGTTCTTGCTGTGTGTATGG + Intergenic
1021586850 7:22218118-22218140 TTGTGTTCTCACTGGGTGAGAGG - Intronic
1022281747 7:28917779-28917801 CTGTCTTTTCACTCTCTTAACGG - Intergenic
1024143485 7:46485805-46485827 CTGTCTTTTCTCTGTGTTCATGG + Intergenic
1024457223 7:49622591-49622613 ATGTGTTCTCTATGAGTTAAAGG - Intergenic
1025151920 7:56561843-56561865 TTGTCTTTTCACTCTGTTAATGG + Intergenic
1025886733 7:65601792-65601814 CTGTGTTCTCACATGGTGAATGG + Intergenic
1027565853 7:79792695-79792717 CAGTTTTCTCACTGTGGAAATGG - Intergenic
1028299901 7:89185397-89185419 CTCTGTTCCCACTGTTTTATAGG - Intronic
1028325491 7:89519131-89519153 CTTTGTTTTCACGGTGTGAATGG + Intergenic
1028442792 7:90882882-90882904 CTTTGTTCTCACTGGTTTCAAGG - Intronic
1028541718 7:91949480-91949502 CTTTTTTCTCACAGTGTAAATGG - Intronic
1028682368 7:93551224-93551246 CAGTGTTAACACTCTGTTAATGG - Intronic
1028840945 7:95429649-95429671 CTGTGTTCCCACTTTGCTTAGGG - Intronic
1028903831 7:96131257-96131279 CTGTTTCCTCCCTGTGTTACGGG - Intronic
1029050928 7:97686554-97686576 TTGTGTCCTCACTGTTTTCAAGG + Intergenic
1029514256 7:101016086-101016108 CTGGGCTCCCACTGTGTTGAAGG - Intronic
1030393142 7:108952091-108952113 CTGTGTTCTCATTTTATTACAGG - Intergenic
1031855685 7:126920148-126920170 CTGTGTTCTCACACGGTGAATGG - Intronic
1032741711 7:134746273-134746295 CTGTGTCCTCACAGAGTGAAGGG - Intronic
1032973984 7:137200743-137200765 CTGTGTTCTCACGCGGTGAAAGG - Intergenic
1033057453 7:138071696-138071718 CTGTGTTCTCACAGTGTGTTGGG - Intronic
1034383196 7:150716945-150716967 CTCTTTTCTTACTTTGTTAAGGG - Intronic
1036021318 8:4850313-4850335 TTGTGTTTTTACTGTCTTAATGG + Intronic
1036400968 8:8407988-8408010 CTGTGTTCTTACTGGGAAAATGG + Intergenic
1037223243 8:16552101-16552123 CCTTATTCTCACTGTGTTCAAGG + Intronic
1037836819 8:22219554-22219576 CTGTGTCCTCACAGGGTGAAAGG - Intergenic
1038149412 8:24929038-24929060 CTGTCTTCTCACTGTACTCAAGG + Intergenic
1041422426 8:57682726-57682748 CTGTGTTTTCATTGTGAAAATGG + Intergenic
1042012041 8:64257421-64257443 CTGTGTCCTCAGTTTGTCAATGG + Intergenic
1042155194 8:65837761-65837783 TTATTTTCTCACTGTATTAATGG - Intronic
1042250844 8:66754881-66754903 TTATTTTCTCACTGTATTAATGG - Intronic
1044536589 8:93363821-93363843 CTGTGTTCTCACTGCATTTGGGG - Intergenic
1045070328 8:98497486-98497508 CTGTATTTTCACTGTCTTGATGG - Intronic
1045095954 8:98798902-98798924 CTGTGTTTTCACATTGTGAAAGG - Intronic
1045432836 8:102129131-102129153 CTGTACTATCACTGTGTTCAGGG - Intergenic
1046816794 8:118593665-118593687 TTGGGTTCTCCCAGTGTTAAAGG - Intronic
1046914059 8:119660904-119660926 TTGTCTTCTCACTCTGTTGAAGG - Intronic
1047763241 8:127969631-127969653 CTGAGTACTCACTGTGTTCCAGG + Intergenic
1048256750 8:132910620-132910642 CTGTCTTCTCACTGTGTCCATGG - Intronic
1048804735 8:138229538-138229560 CTGAGTTATCACTGTGGAAAAGG + Intronic
1049076092 8:140397207-140397229 CTGGGTTACCACTGTGTCAAAGG + Intronic
1050342071 9:4650394-4650416 TTGTGTTCCCAGTGTCTTAAGGG - Intronic
1050676329 9:8058658-8058680 TTGTCTCTTCACTGTGTTAATGG + Intergenic
1052326140 9:27218322-27218344 CTGTGTCCTCACTGTATGCAAGG + Intronic
1053847365 9:42253119-42253141 CTTTGTTCTCACTGGTTTCAAGG - Intergenic
1055158847 9:73099022-73099044 CTGTGTTCTCAATATTTTCATGG + Intergenic
1055532403 9:77197969-77197991 CTGTATTTTCACTGAATTAATGG - Intronic
1055599601 9:77901894-77901916 CTGTGTCCTCACTGAGTAGAAGG + Intronic
1055902050 9:81251482-81251504 CTGTATTTTCACTGTACTAATGG + Intergenic
1056614194 9:88149017-88149039 GTGAGTTCTCACTCTGTTGACGG + Intergenic
1056891171 9:90494279-90494301 CTGCGTTGTCACTGTGGTCATGG + Intergenic
1057052943 9:91939600-91939622 ATCTGTTCTCTCTGTGGTAAAGG + Intronic
1057057790 9:91977315-91977337 CTGTGTTCTCACTTAGTGGAAGG - Intergenic
1057229997 9:93315856-93315878 TTGTGTTTTCACTTTCTTAATGG + Intronic
1059011194 9:110462829-110462851 CTGTTCTCTGACAGTGTTAAGGG + Intronic
1060285607 9:122248918-122248940 CTGAGTTCTCACTGTGTAGTAGG + Intronic
1061850278 9:133410817-133410839 CTGAGTTCTTACTGTGTTTTAGG - Intronic
1185916551 X:4041801-4041823 CTGCATTTTCACTGTGTTGATGG + Intergenic
1186942667 X:14528054-14528076 CTGTATTTTCACTGTCTTACTGG + Intergenic
1190904010 X:54708219-54708241 CTATGTTCACACTGTTTTAAGGG + Intergenic
1192371581 X:70518324-70518346 CTTTGTTCTCACTGGTTTCAAGG + Intergenic
1193084122 X:77433455-77433477 CTGTGTTCTCACATGGTGAAGGG + Intergenic
1193109997 X:77719141-77719163 CTGTGTTTTCACTTTCTTGATGG - Intronic
1193132659 X:77933877-77933899 TTGTTTTTTCACTGTATTAATGG - Intronic
1193568387 X:83108954-83108976 CTGTATCCTGACTGTGTTAGTGG - Intergenic
1193900178 X:87167161-87167183 CTGTGTTCACACTGTGTCTTGGG - Intergenic
1193978408 X:88151650-88151672 CTGTGTTCTCACTTGGAAAAAGG + Intergenic
1194260916 X:91694502-91694524 GTGTGTTCTGACTGTTTCAATGG - Intergenic
1195164573 X:102206486-102206508 CAGTGTACTCACTGTTTTTATGG + Intergenic
1195194286 X:102480608-102480630 CAGTGTACTCACTGTTTTTATGG - Intergenic
1196935043 X:120721428-120721450 CTGTGTGCTCACTTTTTGAAGGG + Intergenic
1198986522 X:142460660-142460682 CTGTATTCTCACTTGGTGAAAGG + Intergenic
1200579568 Y:4933304-4933326 GTGTGTTCTGACTGTTTCAATGG - Intergenic
1201251237 Y:12060014-12060036 CTTTGTTCTCACTGGTTTCAAGG - Intergenic
1201905584 Y:19083149-19083171 CTGTCACCTGACTGTGTTAAAGG + Intergenic