ID: 1169828443

View in Genome Browser
Species Human (GRCh38)
Location 20:9795586-9795608
Sequence TAGATGTTGAATAAAATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 448}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169828443 Original CRISPR TAGATGTTGAATAAAATTTG TGG Intronic
900008647 1:85829-85851 TAGATTTTGTATATAATGTGAGG - Intergenic
900036881 1:419840-419862 TAGATTTTGTATATAATGTGAGG - Intergenic
900058508 1:655579-655601 TAGATTTTGTATATAATGTGAGG - Intergenic
901585561 1:10288264-10288286 TGGTTGTTGAATAACTTTTGTGG + Intronic
901937955 1:12640074-12640096 TCTATGTTCAATAAATTTTGAGG + Intergenic
902076465 1:13790678-13790700 TAGAAGTTGAATACGGTTTGAGG + Intronic
903955947 1:27025900-27025922 TAGAGATTAAATAAAATATGAGG - Intergenic
905117419 1:35654278-35654300 TAGAGATTGGATAAACTTTGTGG + Intergenic
905736354 1:40329475-40329497 TAAATTTTGTATAAAATATGAGG + Intergenic
907252757 1:53153217-53153239 TCAATGTTGAATGTAATTTGGGG + Intergenic
908022540 1:59913333-59913355 TAGATGTTATTTAAAATTTTAGG - Intronic
908081628 1:60585986-60586008 TAGAAATTGAATAGCATTTGGGG - Intergenic
909683248 1:78316420-78316442 TAGAAGCTGAATAAAAAATGAGG - Intronic
909973899 1:82022962-82022984 TAGATGAAGAATAAAATTGTTGG + Intergenic
910731684 1:90404647-90404669 TAGGTGTTTAATAAAATTAAAGG - Intergenic
910841454 1:91565910-91565932 TAAAAGCTGAATAAAATTTTAGG + Intergenic
910987066 1:93015574-93015596 TTGTTGTAGAATAAAATTTTAGG - Intergenic
911987891 1:104654130-104654152 TAAATTTTAAAAAAAATTTGTGG + Intergenic
912056313 1:105603212-105603234 TAGATGTTGGATGAAATTTTAGG + Intergenic
912472715 1:109916559-109916581 TAGATGTGGAATAATGATTGGGG - Intronic
913060482 1:115200866-115200888 TATATGTTGTATCAAATTTATGG - Intergenic
913354604 1:117905344-117905366 TTGCTGTTGCATAAAATGTGAGG - Intronic
915879267 1:159649121-159649143 CAGATGTTGGATAAAATTAAAGG + Intergenic
916581979 1:166117021-166117043 TAAATGCTAAATAAAATATGTGG + Intronic
916653007 1:166848344-166848366 CAGAAGTTGAATATGATTTGGGG - Intronic
917738459 1:177940936-177940958 TAGATTCTAAATAAAATATGAGG + Intronic
918471428 1:184879677-184879699 TAGGTGTTCAATAAATGTTGTGG - Intronic
918549166 1:185720362-185720384 CAGATGTGGCATGAAATTTGGGG - Intergenic
918822345 1:189270913-189270935 TTGATCTTGAAAAAAATCTGAGG + Intergenic
918852934 1:189715799-189715821 TAGAGAGAGAATAAAATTTGAGG + Intergenic
919436239 1:197565280-197565302 AAGATGTTGAATAAAAGGAGTGG - Intronic
919839138 1:201596656-201596678 TAGATGTTCAATAAATATGGTGG - Intergenic
920690214 1:208140731-208140753 TATTTGTTTAATAAAAATTGTGG - Intronic
921579647 1:216881184-216881206 AATATGTTGAAAAAAAATTGAGG - Intronic
922000377 1:221471582-221471604 TAGATGATGAAAAAAATTGAGGG - Intergenic
922646660 1:227293969-227293991 TAAATGTTTAAAAAAATTTTAGG + Intronic
922981421 1:229830164-229830186 TAGAAGTGGAATGAAAGTTGAGG - Intergenic
923563816 1:235061932-235061954 TCGATGTTCAATAACATTTGGGG + Intergenic
923906988 1:238395654-238395676 TTGATGATGAATGAAAGTTGGGG - Intergenic
924504677 1:244670441-244670463 AATATGTAGAACAAAATTTGAGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1065662803 10:28023305-28023327 GAGATTTTGAATACAATTTTTGG - Intergenic
1065844431 10:29733876-29733898 CAAATGTTGTATAAAAGTTGTGG + Intronic
1066612256 10:37261794-37261816 AATATTTTGAATAAAATATGTGG + Intronic
1067113564 10:43417962-43417984 CAGAGATTTAATAAAATTTGTGG + Intergenic
1068242993 10:54328876-54328898 TGGAAGTTTAATAAAATTTCTGG - Intronic
1068650473 10:59517155-59517177 TAGATGTTCAATAATGTTTGTGG + Intergenic
1068688596 10:59893780-59893802 CAGCTGTTCAATAAAGTTTGTGG - Intronic
1068961890 10:62875121-62875143 AAGATGAAGAATAAAATTGGAGG - Intronic
1072535579 10:96360245-96360267 TAAATGATGAAAAAAATATGGGG + Intergenic
1072991467 10:100199300-100199322 TAGAGGTTGGAAAGAATTTGAGG - Intronic
1073917219 10:108419556-108419578 CAAATTTTGAATAGAATTTGTGG + Intergenic
1074691189 10:116005633-116005655 GACATGTTCAATAAATTTTGGGG + Intergenic
1074804493 10:117034739-117034761 TAGATATTTAATTATATTTGTGG - Intronic
1076399558 10:130172619-130172641 TACAGGTTGAATACAATTTCAGG + Intronic
1076656875 10:132030164-132030186 TAGATGTGGTAAAATATTTGAGG - Intergenic
1079137916 11:17786731-17786753 AAAATGTTGAATAAAATCAGTGG + Intergenic
1079723996 11:23856454-23856476 TAGAAAATGAACAAAATTTGGGG - Intergenic
1079795687 11:24799760-24799782 TAGATATTAAATCAAATATGGGG + Intronic
1079853531 11:25569862-25569884 TAGAGATAGAAGAAAATTTGTGG - Intergenic
1081444960 11:43122305-43122327 TAGATGTTCAATTAAACTTTTGG + Intergenic
1081558981 11:44194984-44195006 GAGATGAAGAATAAAATTTGGGG + Intronic
1082204604 11:49417872-49417894 TAGGACTTTAATAAAATTTGGGG - Intergenic
1084278626 11:68071113-68071135 TAGTAGTTCAATAAAATTTAAGG - Intronic
1085056904 11:73410104-73410126 TACATGTTGAAAAAAAATGGCGG + Intronic
1086034713 11:82402666-82402688 TAGATGTTTAATAAAATCTCTGG + Intergenic
1086090920 11:83003895-83003917 CAAATGTTGAATAAATTTTGAGG - Intronic
1086464605 11:87040100-87040122 TAGTTGTGAAATAAAATTAGTGG + Intronic
1086650487 11:89282643-89282665 TAGGACTTTAATAAAATTTGGGG + Intronic
1086789062 11:91012087-91012109 TAGATTTTGTATAAATTTAGGGG - Intergenic
1087329939 11:96768120-96768142 TAGAAATTGAATTATATTTGTGG + Intergenic
1087416523 11:97863092-97863114 TACATCTTGTATAAAATTTTAGG - Intergenic
1087784294 11:102337647-102337669 TATATGTTGAATGACATTTTAGG + Exonic
1087960347 11:104340446-104340468 CAGATGATGAAGAAAATTTTTGG - Intergenic
1088959224 11:114644699-114644721 TAGAGATTTGATAAAATTTGAGG - Intergenic
1089371751 11:117965218-117965240 AAAATGTTGAATAGAATTGGTGG - Intergenic
1090692803 11:129201585-129201607 TAATTGTTAAATAAAATCTGAGG + Intronic
1092334752 12:7621341-7621363 TTGATGTTGGATATAGTTTGTGG - Intergenic
1092451614 12:8607567-8607589 TAGATGATTAATTAAATATGAGG - Intronic
1093217882 12:16384237-16384259 TAGAAGTTGGATACATTTTGGGG - Intronic
1093882864 12:24425529-24425551 TACATGTTTAATGAATTTTGGGG + Intergenic
1094727856 12:33141025-33141047 CAGATGTTAAATATAATTTATGG - Intergenic
1095675648 12:44914704-44914726 TGGATGTTAAATAAAAGTGGAGG + Intronic
1097506764 12:60483406-60483428 TAGCTGTTGAAATAAAGTTGAGG + Intergenic
1097713637 12:62941728-62941750 TTGTTTTTGAATAAAATATGAGG - Intergenic
1098007590 12:66014977-66014999 TAGATGTTGAATAACAACTGTGG - Intergenic
1098033151 12:66274942-66274964 TAAATGTTTAATACAATATGTGG + Intergenic
1098534883 12:71583189-71583211 TAGTTTTAGATTAAAATTTGAGG - Intronic
1098692391 12:73504782-73504804 TATTTGTAGAATAAAATGTGTGG + Intergenic
1099349790 12:81551192-81551214 CAGATGTTCAATAAAGTTTATGG + Intronic
1100575145 12:95884049-95884071 TTGATGTTGAATAAGAGTAGAGG - Intronic
1101891790 12:108723141-108723163 TAGATGGTGAATTAATTTTGTGG - Intronic
1103163706 12:118752502-118752524 TAGATTTTATTTAAAATTTGTGG + Intergenic
1104232003 12:126894370-126894392 CAGATTTTTAATAAAATTTCTGG - Intergenic
1105539252 13:21300677-21300699 TACATGATGAAAAAAATATGAGG + Intergenic
1106317088 13:28603778-28603800 TAGATGTTTAAAGAAATTAGGGG + Intergenic
1106375955 13:29188570-29188592 TAGATGTTGGATAGAGTTTTGGG - Intronic
1106837659 13:33652484-33652506 TAGATTGTGAATAAAATGTATGG - Intergenic
1107130550 13:36889872-36889894 TTGATGTTGCATAAGATCTGGGG - Intronic
1107346928 13:39471896-39471918 TAGTTGTTGAAAAAAATGTTAGG - Intronic
1107525713 13:41229300-41229322 TAAATGATAAATAAATTTTGAGG - Intronic
1107533405 13:41306004-41306026 TAACTGATGAATAAAATTTGAGG + Intergenic
1107827657 13:44343828-44343850 TATATTTTGACTAAAGTTTGAGG + Intergenic
1108764350 13:53608469-53608491 TAGCTCTTGAATAAAATCGGAGG - Intergenic
1109285392 13:60402658-60402680 TAGATGCTGAAGAACATTAGAGG + Intronic
1109846448 13:67997342-67997364 TAAATGTTGAAATATATTTGAGG - Intergenic
1110357242 13:74581241-74581263 TAAAAGTAGAATAAAATGTGGGG + Intergenic
1111625144 13:90775239-90775261 TACTTGTTGAATAAAAGTTAGGG + Intergenic
1111653182 13:91118789-91118811 CAGATGGTGAATAAAAATTTTGG - Intergenic
1112550171 13:100412066-100412088 TAGAATTTGAATAGAGTTTGTGG + Intronic
1113110800 13:106821493-106821515 TAGATGGTGAAAAGAATTTCGGG + Intergenic
1113204806 13:107904853-107904875 TAGATGATAAAAGAAATTTGAGG + Intergenic
1113297628 13:108977958-108977980 TAAATGTTGAAATATATTTGCGG - Intronic
1113581877 13:111435676-111435698 AAGATGTTTCATAAAAATTGTGG - Intergenic
1114942905 14:27638358-27638380 TAGATACTTAATAAAATTTTAGG - Intergenic
1115457759 14:33624258-33624280 TAGGTGTTCAATAATATTTGTGG + Intronic
1115674102 14:35649887-35649909 TAAATGTTTAATAAATTTAGTGG + Intronic
1115898889 14:38122682-38122704 TTGAAGCTGAGTAAAATTTGGGG - Intergenic
1116211845 14:41956959-41956981 TAGGTGTTCCTTAAAATTTGGGG - Intergenic
1116580033 14:46628841-46628863 TAGATGGAGAAGAAAATTTGAGG + Intergenic
1117286980 14:54295432-54295454 TAGATATATAATAACATTTGAGG + Intergenic
1117836785 14:59816054-59816076 GTGATGTTGAATAAACTATGTGG - Intronic
1117853474 14:60001811-60001833 TAGATATTGAAAACAATTTAAGG + Intronic
1118060212 14:62129072-62129094 TACAGGTTGGTTAAAATTTGTGG + Intergenic
1120362787 14:83527070-83527092 TAGTTTTTAAATAAAATTAGGGG + Intergenic
1120630964 14:86889548-86889570 TTGATGTGGAAAAATATTTGTGG - Intergenic
1120870768 14:89335216-89335238 TAATTGATGAATAAAAATTGTGG - Intronic
1123502398 15:20901514-20901536 TCGATGTTGAGTAAGTTTTGAGG + Intergenic
1123559648 15:21475198-21475220 TCGATGTTGAGTAAGTTTTGAGG + Intergenic
1123595884 15:21912495-21912517 TCGATGTTGAGTAAGTTTTGAGG + Intergenic
1124102337 15:26707383-26707405 AAGATGTTGAATGAAAACTGTGG + Intronic
1125206938 15:37163963-37163985 TACAAGTTGAACAAAATTTTTGG - Intergenic
1126506470 15:49409718-49409740 AAGAAGTGGAATAAAATTTGAGG - Intronic
1127682039 15:61306904-61306926 TAGATTTTCCATAATATTTGTGG + Intergenic
1128046589 15:64623354-64623376 TAGATTATAAATTAAATTTGAGG + Intronic
1128197274 15:65770447-65770469 TAGATTTTAAAGAAAATATGAGG - Intronic
1128630465 15:69260672-69260694 TAAATGTTTAAGAAAATTTCAGG + Intronic
1130183495 15:81654274-81654296 TAATTGTTCAAAAAAATTTGAGG - Intergenic
1131500059 15:92953647-92953669 TAGATCATCAGTAAAATTTGTGG + Intronic
1131504288 15:93002378-93002400 TAGAAGTAGAATGAGATTTGAGG + Intronic
1131678562 15:94697729-94697751 TAGATGCTCAATAAATTTTGTGG + Intergenic
1131682124 15:94734650-94734672 TAGTTGTTTAATAATAATTGTGG + Intergenic
1131758865 15:95597874-95597896 AAGATGCTGAATGAAATTGGGGG - Intergenic
1131808113 15:96144273-96144295 TAGATGCAGTAAAAAATTTGAGG - Intergenic
1202967993 15_KI270727v1_random:202358-202380 TCGATGTTGAGTAAGTTTTGAGG + Intergenic
1133476690 16:6129112-6129134 CATATGTTTAATAAATTTTGTGG - Intronic
1137354353 16:47745348-47745370 TAGAACTTGAATCAACTTTGAGG - Intergenic
1137769910 16:51007874-51007896 TATATGTTGAATAAAATAAATGG + Intergenic
1138127883 16:54453742-54453764 TAGGTGTTCAATAAACATTGGGG + Intergenic
1138730844 16:59193175-59193197 TAGGTGTTTAGTAAAGTTTGAGG - Intergenic
1138854591 16:60673733-60673755 TTGATGCTCAATAATATTTGAGG - Intergenic
1138967417 16:62101492-62101514 TAGATGCTTAATAAAATTTGTGG - Intergenic
1139073255 16:63410271-63410293 TACATGTTAATTAAAATTAGTGG + Intergenic
1139456653 16:67084681-67084703 TACATAATGAAGAAAATTTGTGG + Intronic
1140569204 16:76082957-76082979 CAACTCTTGAATAAAATTTGAGG - Intergenic
1140669510 16:77263301-77263323 GAGATGTTGGATAACATTTGGGG - Intronic
1141183398 16:81770028-81770050 TAGATATTCAATAAATGTTGTGG + Intronic
1142661895 17:1436320-1436342 TAGATGAGGAAAAACATTTGAGG + Intronic
1142786563 17:2228661-2228683 TATATGTAAAATATAATTTGGGG - Intronic
1144594144 17:16552393-16552415 TTGATGTTGAATAAGGGTTGAGG + Exonic
1146829365 17:36054909-36054931 AATATCTTGAATAAAGTTTGGGG + Intergenic
1147506791 17:41026255-41026277 TTGATGTTGCAAAAAATTTTAGG + Exonic
1147911531 17:43858911-43858933 TAGGTGTTCAATAAAAGATGAGG - Intronic
1149025320 17:52020645-52020667 TAGAAGTTGAATAAAAGTTATGG - Intronic
1149025374 17:52021115-52021137 TAAAAGTTGAATAAAAGTTATGG + Intronic
1149584812 17:57779087-57779109 TAGAAGTTAAATAAATTATGAGG + Intergenic
1149682443 17:58515466-58515488 TAGATGCTTAATAAAATGTCAGG - Intronic
1151134175 17:71929491-71929513 AAATTGTTGAAGAAAATTTGGGG + Intergenic
1151736569 17:75945053-75945075 TAGATTTTAAATAAAACGTGAGG + Exonic
1155077274 18:22370262-22370284 TTGATGTTCAATAAATATTGTGG + Intergenic
1156107743 18:33686064-33686086 TAGAGGTTGAAGAAAATATTGGG - Intronic
1156639906 18:39080742-39080764 AAGATGTTGAAGAAAATGTGTGG + Intergenic
1157707863 18:49822834-49822856 TAGCTGTGGATAAAAATTTGTGG - Exonic
1158053445 18:53251739-53251761 TAGATGCTGAATATCATTAGTGG + Intronic
1158178476 18:54685182-54685204 TAGACGTGGAATAAAATGTTGGG - Intergenic
1159230378 18:65600198-65600220 TAGATGTAGAAAATAATTTAAGG + Intergenic
1159332921 18:67024555-67024577 TAGATGTAGACTAAAATTATAGG + Intergenic
1159520793 18:69519536-69519558 TAGATGTTGGCTAAAATGTTAGG + Intronic
1159804918 18:72944621-72944643 TTTATGTTGAATATAATTTAGGG - Intergenic
1159977405 18:74730911-74730933 TTGATGTTGAACAATATTTTAGG + Intronic
1160640410 19:127389-127411 TAGATTTTGTATATAATGTGAGG - Intergenic
1161833463 19:6627801-6627823 TAGGTTTTCACTAAAATTTGAGG - Intergenic
1162239936 19:9342965-9342987 TAGATGTCGAATAAGATATGTGG - Exonic
1163167138 19:15506281-15506303 TGGATGTTGAATAATATCTCTGG + Intergenic
1164174291 19:22755644-22755666 TTTATGTTGAGTAAAGTTTGAGG + Intergenic
1165183119 19:33989935-33989957 TAAATGTTGAATAAAGTTGTAGG + Intergenic
1165990751 19:39811733-39811755 TAGATGTTCCATATAATTAGGGG + Intergenic
1166472337 19:43088996-43089018 GAGATGTTATGTAAAATTTGAGG + Intronic
1167855436 19:52234353-52234375 TAGAGGTTGAATAAACATTAAGG + Intergenic
925753932 2:7115599-7115621 TAGAGGTTGAATTCATTTTGTGG + Intergenic
927405712 2:22763954-22763976 TAGGTGTTCAATAATATTTGTGG - Intergenic
929709890 2:44256112-44256134 TGGTTGTTAAAAAAAATTTGGGG - Intergenic
930485057 2:52001087-52001109 TAGATTTAGAATACATTTTGAGG - Intergenic
930960671 2:57256640-57256662 TATTTGCTTAATAAAATTTGTGG - Intergenic
932238037 2:70136714-70136736 TAAATTTTAAATAAATTTTGTGG - Intergenic
935054465 2:99553583-99553605 GAGTTGTGGAATAAAATTTGGGG - Intronic
936054813 2:109254552-109254574 TAGATGCTGATTAAAACTTGAGG + Intronic
936652417 2:114443424-114443446 CAGGTGTTGTTTAAAATTTGAGG + Intronic
936747005 2:115589405-115589427 TAAATGCTGATTAAAATTTTAGG + Intronic
937698104 2:124831582-124831604 TAGATTTTGACTAAAATTTAAGG - Intronic
937749146 2:125453596-125453618 TAGATCCTGAATCATATTTGAGG - Intergenic
938253577 2:129834827-129834849 TAGAGGTTGCATTAAATCTGTGG - Intergenic
939193862 2:138948330-138948352 TAGAAGTGGAATCCAATTTGAGG - Intergenic
939203867 2:139074556-139074578 TAGAGGTTAAATAAAATGAGGGG - Intergenic
939422184 2:141986152-141986174 TAGATGTTATAAAAAATTTCTGG + Intronic
939699408 2:145371580-145371602 TGGATGAGGAATAAAATTTTGGG + Intergenic
939792868 2:146601486-146601508 TAGATCTTGCATAAAAGTTTGGG - Intergenic
940570957 2:155432445-155432467 TTGGTGTTGAATAAAAGCTGAGG - Intergenic
941325385 2:164108312-164108334 TGGATGCTAAATAATATTTGAGG + Intergenic
942346944 2:175013466-175013488 TAGATGTGGAATCCCATTTGAGG - Intergenic
942351063 2:175053377-175053399 TAGATGTTGAATTAAATTATTGG + Intergenic
943893053 2:193316565-193316587 AGAATGTTAAATAAAATTTGGGG - Intergenic
945441647 2:209886959-209886981 TAGATGATGAATAAAGGGTGAGG - Intronic
945590846 2:211729258-211729280 AACATGTTAAATAAAAATTGTGG - Intronic
945671805 2:212811082-212811104 TACATTTTGAATAAAATTACAGG - Intergenic
946869117 2:224070038-224070060 AAGATGTTGAATAGAAGTTGGGG + Intergenic
947556031 2:231093960-231093982 TAGATGTTTAATAATATATTGGG + Intronic
948917741 2:241045353-241045375 TTGATGAAGAATAAATTTTGAGG + Intronic
1168802394 20:652024-652046 TAGATGTATAATATAATTTCTGG + Intronic
1169292654 20:4365842-4365864 AAGAAGTTGGATGAAATTTGAGG + Intergenic
1169522052 20:6384755-6384777 TAGATATTGAAAAACATCTGGGG - Intergenic
1169828443 20:9795586-9795608 TAGATGTTGAATAAAATTTGTGG + Intronic
1170159667 20:13298518-13298540 TAGATGCTTACTAAAATTTAGGG + Intronic
1170917968 20:20646685-20646707 TAGATTCTGAAAAAAATTTAAGG + Intronic
1170958477 20:21003386-21003408 TACATGATGAATAGAATTTGGGG - Intergenic
1171331473 20:24342778-24342800 TAAATGATGTATAAAAATTGTGG + Intergenic
1171334803 20:24373899-24373921 GATATGTTGAATAAAATATTAGG + Intergenic
1173447316 20:43130595-43130617 TACATATTGAAAAAAAATTGGGG + Intronic
1173887673 20:46475288-46475310 TCGTTTTTGTATAAAATTTGAGG - Intergenic
1174839041 20:53884480-53884502 TAGTTGCTCATTAAAATTTGTGG - Intergenic
1174848788 20:53970707-53970729 TAAGTGTGGTATAAAATTTGAGG - Intronic
1177041652 21:16120100-16120122 GACATGTTGAATAAAAATGGTGG + Intergenic
1177079509 21:16620980-16621002 AAGTAGTTAAATAAAATTTGTGG - Intergenic
1177303271 21:19278010-19278032 TAGATGTAGATATAAATTTGGGG + Intergenic
1178425452 21:32475429-32475451 TAGCTGATGAGTAACATTTGTGG - Intronic
1179766869 21:43581016-43581038 AAGATGTGGAATCAAAGTTGGGG + Intronic
1180257083 21:46637282-46637304 GAGCTGTTCAATAAAATTTCAGG + Intronic
1182646535 22:31814603-31814625 TAGATTTAGATTCAAATTTGAGG + Intronic
1183043680 22:35202762-35202784 TAGAAGAAGAATAAAGTTTGTGG + Intergenic
1183202062 22:36392178-36392200 TAGATTTTGAAAAACATTTCTGG + Intergenic
1183826268 22:40390136-40390158 TTTATGTTGAATTAAATGTGGGG + Intronic
949305093 3:2630734-2630756 TATATGTTTAATAAAATCTTAGG + Intronic
949319473 3:2792823-2792845 TACATCTTATATAAAATTTGAGG - Intronic
952434609 3:33260009-33260031 TAGATTTTTAAGATAATTTGAGG + Intergenic
954917315 3:54159702-54159724 TAGATTTTTAAAAAATTTTGTGG - Intronic
955841049 3:63113135-63113157 GAGATGCTGAGTAAGATTTGAGG - Intergenic
955905137 3:63799334-63799356 TAGATGTCCACTAATATTTGAGG - Intergenic
957975110 3:87433259-87433281 TATAAGTTAAATAAAATGTGGGG + Intergenic
958002778 3:87772190-87772212 TATGTTTTTAATAAAATTTGGGG - Intergenic
958020259 3:87985941-87985963 TTCATGTTGAATAAAACCTGGGG + Intergenic
958662677 3:97091650-97091672 TGTATGTTAAATAATATTTGTGG + Intronic
958914780 3:100037120-100037142 TAAAATTTGAATAAAATGTGGGG + Intronic
959181133 3:102981821-102981843 TGAATGTGGAATAAAATTTATGG - Intergenic
959645340 3:108693194-108693216 TTGTTTTTGAATAAAATATGAGG + Intronic
960023372 3:112980888-112980910 TAAAATTTGAATAAAATTTCAGG - Intergenic
960171646 3:114468856-114468878 TAGGTGTGGCATAAAATATGGGG + Intronic
961083564 3:124046716-124046738 TTGATGTTCCATAAAGTTTGGGG - Intergenic
961713445 3:128843953-128843975 TAGATGCTGAAAACATTTTGTGG - Intergenic
961947163 3:130703503-130703525 TAGATGGTTAAAAAAAATTGTGG - Intronic
962314031 3:134347224-134347246 ACAATGTTGAATAGAATTTGTGG - Intergenic
962909249 3:139832713-139832735 TAGGTGTTGAAAACCATTTGGGG - Intergenic
962932015 3:140047326-140047348 TATATGTTGTATATCATTTGTGG - Intronic
963455421 3:145540628-145540650 TAGAAATTGAATTGAATTTGTGG + Intergenic
963565905 3:146930120-146930142 AAGTTGGTGAATAAAATTTGGGG + Intergenic
963722743 3:148881966-148881988 TCAATTTTGAATAGAATTTGAGG + Intronic
964603578 3:158531890-158531912 TGGCTATTCAATAAAATTTGTGG - Intronic
964681781 3:159348327-159348349 TAGATGTCATATAAATTTTGAGG + Intronic
964702215 3:159581094-159581116 TAGATAAATAATAAAATTTGGGG + Intronic
964879194 3:161404924-161404946 CAGCTGTTAAATAAAATTTATGG + Intergenic
965249300 3:166322023-166322045 TAGATGTTGAATAGCATATTAGG + Intergenic
965500849 3:169454933-169454955 TAGATGTGAGATAAAAATTGGGG - Intronic
966249598 3:177848704-177848726 TGGATGTTCAAAAGAATTTGAGG + Intergenic
966525969 3:180919603-180919625 TACATGTTGGATAATATTTTAGG + Intronic
966603388 3:181797389-181797411 TTTATGTACAATAAAATTTGGGG + Intergenic
968941083 4:3638316-3638338 TAGAAGGTGCATAAACTTTGAGG - Intergenic
969131332 4:4993130-4993152 TAGGTCTTGAATCATATTTGTGG + Intergenic
970343835 4:15134340-15134362 GAGATAGTGAATAAAATCTGGGG - Intergenic
970659725 4:18270329-18270351 TAAGTGTTTAAAAAAATTTGGGG + Intergenic
970939012 4:21609223-21609245 TAAATTTTGAATAAAATTATGGG + Intronic
971616099 4:28792249-28792271 TAGATGCTGCATAAAATTTGTGG - Intergenic
971939336 4:33194058-33194080 TAAATGTTGTAAATAATTTGTGG + Intergenic
971957723 4:33443945-33443967 TAAATTTTGAAGACAATTTGTGG + Intergenic
972038750 4:34561771-34561793 TGGATGTGTAATAAAAATTGTGG - Intergenic
972129422 4:35811942-35811964 TAGAAGTTGAATACATTGTGTGG - Intergenic
972458513 4:39277249-39277271 TAGATGTTGCAGGAAATTTGAGG - Intronic
973155181 4:46942917-46942939 TAGATGTTAGAAAAAATTGGGGG - Intronic
973254993 4:48101498-48101520 TAAATGCTGAATAAAATATAAGG + Intronic
974565377 4:63574028-63574050 TACATGTTTAATCAAATCTGAGG + Intergenic
976814931 4:89137456-89137478 TTGAATTTGAATAAAATTTACGG - Intergenic
976892532 4:90067633-90067655 TAGAAGTTAAAAAAAGTTTGTGG - Intergenic
977178040 4:93839284-93839306 GAGATGTTGAACAAAATGTTGGG - Intergenic
978236005 4:106461429-106461451 CAGATTGTGAATAAATTTTGGGG + Intergenic
978243681 4:106547614-106547636 TTGATCAAGAATAAAATTTGTGG - Intergenic
978553798 4:109957138-109957160 GTGATGTTAAATAAAATTTATGG + Intronic
978903588 4:113980692-113980714 TAACTGTTGAATAAATTTGGTGG - Intergenic
979697033 4:123624169-123624191 TAGATGTTTAATAAAAATATTGG - Intergenic
979897918 4:126183944-126183966 TAAATGTAGAAGATAATTTGTGG + Intergenic
979918091 4:126464728-126464750 ACGATGATAAATAAAATTTGGGG + Intergenic
980303852 4:131030786-131030808 TAGATTTAAAGTAAAATTTGTGG + Intergenic
980375613 4:131943549-131943571 TAGATGTTTATGAAACTTTGAGG - Intergenic
980818485 4:137980543-137980565 TAGATTCTGAAGAAAATATGTGG + Intergenic
981679149 4:147374910-147374932 AAGAAGAAGAATAAAATTTGAGG - Intergenic
981707207 4:147672749-147672771 AAGATCTTGAGAAAAATTTGTGG - Intronic
982258129 4:153469491-153469513 TAGGTGTTAATTTAAATTTGAGG + Intronic
982774539 4:159428162-159428184 GAGATGTTCAATACATTTTGTGG + Intergenic
982894936 4:160908180-160908202 TAAATGGTGAAAAAAGTTTGTGG - Intergenic
983748956 4:171239345-171239367 TAAATGTTGAGTAGAGTTTGAGG + Intergenic
983872641 4:172839732-172839754 AAAATGTTGAATAACCTTTGAGG + Intronic
984213019 4:176873908-176873930 TAGTTTTTAAATAAAATTTAAGG + Intergenic
984740188 4:183154029-183154051 TAAATGATGAATTAGATTTGGGG - Intronic
985159521 4:187029846-187029868 TAGATGTTAAATGAAATTGGTGG - Intergenic
986210716 5:5668667-5668689 TAGATGTTGAAACAATTTTTTGG + Intergenic
987452379 5:18102293-18102315 TAGATGTTGAATCAAGAATGAGG + Intergenic
987658425 5:20839333-20839355 TAGATGTTTATTCAAATTTCAGG + Intergenic
987814885 5:22887220-22887242 TAGAGGTTGGATAAAAGATGAGG + Intergenic
987971457 5:24950855-24950877 TTGCTGATGAATAAATTTTGGGG + Intergenic
988022660 5:25643106-25643128 GAGTGGTTGAATGAAATTTGAGG + Intergenic
988765260 5:34366611-34366633 TAGATGTTTATTCAAATTTCAGG - Intergenic
989218800 5:38932174-38932196 TTGCTGTTGAAAAAATTTTGTGG - Intronic
989772729 5:45164112-45164134 TAGAAGTTCAACAATATTTGTGG - Intergenic
989814195 5:45715974-45715996 GTGATGTTTAAAAAAATTTGAGG - Intergenic
990636051 5:57727982-57728004 AAGATTTTGAATAAAAGTTGGGG - Intergenic
991008743 5:61859348-61859370 TATAAGATGAATAAATTTTGGGG + Intergenic
992359144 5:76018243-76018265 GACATTTTTAATAAAATTTGAGG - Intergenic
992718758 5:79538011-79538033 AAGATATTGAACAAAATTTTTGG + Intergenic
992816413 5:80444839-80444861 TAGAGACTGAATAAAATTTAGGG - Intronic
992988291 5:82256555-82256577 TAGATGTTGTACATTATTTGAGG - Intronic
993243733 5:85425030-85425052 TAGATGTAGGAAAAAATTGGGGG - Intergenic
993426503 5:87771182-87771204 TAAATGTTAAGTATAATTTGTGG + Intergenic
993640563 5:90400003-90400025 TTGAAGTTGGATTAAATTTGAGG - Intronic
993806607 5:92418200-92418222 TAAATATTGTAAAAAATTTGTGG + Intergenic
994069158 5:95579121-95579143 TGAATTTTGATTAAAATTTGAGG + Intronic
994559057 5:101344586-101344608 TAGAAGCTGGAAAAAATTTGAGG + Intergenic
994783933 5:104130784-104130806 GGGATGTTGAATATCATTTGTGG + Intergenic
995046942 5:107661233-107661255 AACATGTTGAATAAAATTATTGG + Intronic
995100916 5:108304353-108304375 TAAATGTTGAATAAACCTTCTGG - Intronic
995174134 5:109154717-109154739 GGTAGGTTGAATAAAATTTGTGG - Intronic
995230996 5:109763252-109763274 TCTATGTTAAATAAAATTTATGG - Intronic
995736793 5:115310188-115310210 TAGATTTAGTATAAAATTTTGGG - Intergenic
995778986 5:115755779-115755801 TGGATGGTGAATGAAATCTGGGG + Intergenic
996159997 5:120149356-120149378 TATATTTTGTATACAATTTGGGG - Intergenic
996204891 5:120721105-120721127 TAGTTGTTCAATAAAATGTATGG + Intergenic
996992659 5:129654462-129654484 TATATGTTGAAGGAAAATTGTGG + Intronic
997009676 5:129861557-129861579 GAGATGATGAATATCATTTGTGG + Intergenic
997539566 5:134650393-134650415 TAAATGTTGAAGCACATTTGAGG - Intronic
997707550 5:135972208-135972230 GAGATGGTGAATAAAAGTTGGGG - Intergenic
997910421 5:137866635-137866657 CAGATGTTGAAGAATATTTTGGG + Intergenic
997937168 5:138122980-138123002 TATAAGTTAAAAAAAATTTGGGG - Intronic
998056258 5:139080577-139080599 TAGACCCTGAACAAAATTTGAGG - Intronic
998215309 5:140234127-140234149 TAGTTTTTGTATAAAATGTGAGG + Intronic
998785657 5:145705975-145705997 AACATTTTGAATCAAATTTGTGG - Intronic
999231138 5:150062630-150062652 TAGATGTTCAAGAAAGTATGTGG - Intronic
999553649 5:152717828-152717850 TTGTGGTTGAATAAAATTTATGG - Intergenic
1000507909 5:162144840-162144862 TAAATGTTCAATTAAATTTAAGG - Intronic
1000568242 5:162879026-162879048 TAGATTTTCACTAAAATTTAAGG - Intergenic
1001318692 5:170662837-170662859 TAGATCTTGAAGAATATGTGAGG - Intronic
1001335640 5:170794598-170794620 TTGGTGATGGATAAAATTTGGGG + Intronic
1001561058 5:172669286-172669308 TAGCTTTTGAATAAAAGTAGGGG + Intronic
1002736940 5:181399026-181399048 TAGATTTTGTATATAATGTGAGG + Intergenic
1002747759 6:75792-75814 TAGATTTTGTATATAATGTGAGG - Intergenic
1004002362 6:11606891-11606913 TAAATTTGGAATAAAATTTCAGG - Intergenic
1009447319 6:63757839-63757861 TAAATTTTAAATAATATTTGTGG - Intronic
1009594949 6:65723261-65723283 TATGTGTTAAATAAAATTTTAGG + Intergenic
1010486437 6:76420202-76420224 TAGATTTATAATAAAATTAGTGG + Intergenic
1010702900 6:79073288-79073310 TATATGATGAATAAAATGTTAGG - Intronic
1011050422 6:83142201-83142223 TAAGTATTGATTAAAATTTGAGG + Intronic
1011202807 6:84855870-84855892 TATAAGTTGAATAAATTCTGAGG + Intergenic
1011430250 6:87278550-87278572 AAGATGTTCAATAATATTTCCGG - Intergenic
1011535456 6:88371545-88371567 TAGATGTTGAATAAACAAAGCGG + Intergenic
1012183874 6:96189468-96189490 TAGATGTACACTAAAATTTGGGG - Intronic
1012317980 6:97803910-97803932 TAGATGTTGTCTAAAATTTTAGG - Intergenic
1012507689 6:99967832-99967854 TAGAGGTTGAATAGAATGTAAGG - Intronic
1012543049 6:100384145-100384167 TAGGTATTCAATAAAAGTTGTGG + Intergenic
1013784211 6:113761399-113761421 TAGATTATGGATAAAATATGAGG + Intergenic
1014526518 6:122507909-122507931 GAGATGTTTAAAAAAATTTAAGG + Intronic
1014731931 6:125042453-125042475 TATGTGTTCAATAAAATATGAGG + Intronic
1015358774 6:132311813-132311835 TTTATGTTGAGTAGAATTTGAGG + Intronic
1015413430 6:132920844-132920866 CTTATGTTGAACAAAATTTGGGG - Intergenic
1016232950 6:141828455-141828477 TAGATTTTCACTAAAATTTAAGG - Intergenic
1017339475 6:153304321-153304343 TAAATGTTGAATAAAATAAAAGG + Intergenic
1017677493 6:156828567-156828589 TAGATGTTGAATTTTATTTTTGG - Intronic
1018533636 6:164795169-164795191 TAGTATTTGAAAAAAATTTGGGG + Intergenic
1018600785 6:165538266-165538288 TATTTGTTGAAAAAAATTTAAGG + Intronic
1019242037 6:170674560-170674582 TAGATTTTGTATATAATGTGAGG + Intergenic
1019256107 7:52618-52640 TATATTTTGAATACATTTTGTGG - Intergenic
1019466872 7:1194551-1194573 TTGATGTTGCATAAATGTTGGGG + Intergenic
1020526782 7:9271973-9271995 TAGATTTTGATGGAAATTTGTGG - Intergenic
1020700193 7:11472253-11472275 TTGACCTTGAATAAGATTTGGGG - Intronic
1020855031 7:13409070-13409092 TACATGCTGAATAAAATCTCTGG - Intergenic
1021179740 7:17492216-17492238 TAAATGTTGAATTAAATTTGGGG - Intergenic
1021222470 7:17989889-17989911 CAGATGTTGAATAAAAGTGAAGG - Intergenic
1021344027 7:19500893-19500915 AAGTAGTTGATTAAAATTTGAGG + Intergenic
1021364072 7:19754214-19754236 TAAATGTTAAATAAAATTGTAGG + Intronic
1021831096 7:24610420-24610442 TAGATGTTGAAGAAAATATATGG - Intronic
1021913521 7:25409405-25409427 TAGATGTTGAGAATAGTTTGGGG + Intergenic
1022195106 7:28057741-28057763 AATATTTTGAACAAAATTTGGGG - Intronic
1022603646 7:31786484-31786506 TAGAAGTTGAATAAATTTTCAGG + Intronic
1022759189 7:33328560-33328582 CTGAGGTAGAATAAAATTTGGGG + Intronic
1024596539 7:50942111-50942133 TTGATGTGGAACAAAATGTGTGG + Intergenic
1026106664 7:67426517-67426539 TAAATGTTTAAATAAATTTGGGG + Intergenic
1027569074 7:79840152-79840174 TATATATTGCATATAATTTGTGG + Intergenic
1028249304 7:88522329-88522351 TATATGTTTAAGACAATTTGGGG - Intergenic
1029168167 7:98610895-98610917 TAGAATTTGAATAAAATTGGGGG + Intergenic
1029294144 7:99526113-99526135 CCGATGCTGAATAAAGTTTGAGG - Exonic
1029521527 7:101065889-101065911 TAGATGTTTAAAAAACTTTGTGG - Intergenic
1029791899 7:102852316-102852338 TACAAATTGAATAAATTTTGTGG - Intronic
1029897713 7:104003042-104003064 TATAAATGGAATAAAATTTGTGG + Intergenic
1030828785 7:114195554-114195576 TAACTGTTCAATAAAATTAGTGG - Intronic
1030926147 7:115457268-115457290 TATATGTTGAATAAATATTGAGG - Intergenic
1031473391 7:122193434-122193456 AAGAAGTTGCTTAAAATTTGGGG - Intergenic
1032249336 7:130240792-130240814 ATGCTGTTAAATAAAATTTGTGG - Intergenic
1032984763 7:137325605-137325627 TAAATATTGATTAAAATATGTGG - Intronic
1033496586 7:141903386-141903408 TAAATGTAAAATATAATTTGGGG - Intergenic
1035078180 7:156194859-156194881 TACATGTTGAAAAGGATTTGGGG + Intergenic
1035506080 8:133541-133563 TAGATTTTGTATATAATGTGAGG - Intergenic
1037064512 8:14560318-14560340 TATATGTTGTATATATTTTGGGG - Intronic
1039687158 8:39815987-39816009 TAAATGTTGAAAAAAAAATGTGG + Intronic
1039933435 8:42016938-42016960 GAGATATTGATAAAAATTTGGGG - Intronic
1040506262 8:48051550-48051572 TAGTTTTAGAATAAAATTAGTGG - Intronic
1041209185 8:55530278-55530300 AAGATATTAAATAAAATTTAGGG - Exonic
1041352262 8:56959256-56959278 TGGATGTTGAATTAATTTTGTGG - Exonic
1042187117 8:66147818-66147840 TATCTGTTGAATAGATTTTGTGG - Intronic
1042269701 8:66942494-66942516 TAGAGGTTTAATCAAACTTGAGG - Intergenic
1042478193 8:69273791-69273813 TATATGTTGAATGAATTTTAGGG - Intergenic
1043019501 8:74983972-74983994 AAGATGTTCAATAGAATTTGGGG - Intergenic
1043208032 8:77472958-77472980 TAAATGTTCAATAAAACATGTGG + Intergenic
1044007240 8:86953127-86953149 TATATGTTGATGAACATTTGTGG + Intronic
1044247420 8:89965438-89965460 TAGTTGTTTGTTAAAATTTGAGG - Intronic
1044269895 8:90229902-90229924 TACCTGTTAAATAACATTTGGGG - Intergenic
1044762340 8:95534610-95534632 TAAATTTTGAATATAATGTGAGG - Intergenic
1045549907 8:103162381-103162403 TATTTGTTGAATAAAATTGCTGG + Intronic
1046057275 8:109093742-109093764 TGAATGTTTAATTAAATTTGGGG + Intronic
1046354290 8:113059617-113059639 TAAATGTTGAAAAAGATCTGAGG + Intronic
1046521903 8:115335814-115335836 TAGGTGTTCCATAAAGTTTGAGG + Intergenic
1046909276 8:119608149-119608171 AATATATTGAATAACATTTGTGG - Intronic
1047298441 8:123591593-123591615 AAAAGGTTGAAAAAAATTTGGGG - Intergenic
1047323371 8:123811544-123811566 TTGATGATGAATTAAATGTGAGG + Intronic
1047487022 8:125340556-125340578 TAGATGCTGAATTATATTTTTGG + Intronic
1047833373 8:128660362-128660384 AAGATCTAGAATAAATTTTGTGG - Intergenic
1048100440 8:131345219-131345241 AAGATATTGAATATAATTTCAGG + Intergenic
1050110945 9:2215230-2215252 TAGAAGTTAAATAACTTTTGTGG - Intergenic
1050895458 9:10880536-10880558 TTGATATTGCATAAAATTTGAGG + Intergenic
1051096045 9:13466245-13466267 TAGATGTAAAACAAAATTTGCGG + Intergenic
1051247289 9:15124804-15124826 GAGATGTTAAATAAAATTTATGG + Intergenic
1051637728 9:19196260-19196282 AAGAGGAAGAATAAAATTTGAGG + Intergenic
1052106696 9:24526158-24526180 TAGATGCTTCATAAAATATGTGG - Intergenic
1052517960 9:29508328-29508350 TAGATCTTGAAGAATATTTTTGG - Intergenic
1053640655 9:40074189-40074211 TAGATGTTTATGAAACTTTGAGG - Intergenic
1053765481 9:41391273-41391295 TAGATGTTTATGAAACTTTGAGG + Intergenic
1054321344 9:63670181-63670203 TAGATGTTTATGAAACTTTGAGG - Intergenic
1054331187 9:63757515-63757537 TAGCTGTGGATAAAAATTTGTGG - Intergenic
1058171628 9:101688312-101688334 TACATGTAGAATAAAAAGTGAGG + Intronic
1058311164 9:103504700-103504722 AAGATTATGAATATAATTTGTGG + Intergenic
1058912978 9:109537959-109537981 TAGAATATGAATAAAGTTTGTGG - Intergenic
1059037716 9:110775727-110775749 TACATGTTAAAGCAAATTTGTGG - Intronic
1059793953 9:117670487-117670509 TAAATTTTGGATATAATTTGGGG - Intergenic
1060075945 9:120590689-120590711 TAGGTGTTTAATAAATATTGAGG + Intergenic
1202798563 9_KI270719v1_random:150434-150456 TAGCTGTGGATAAAAATTTGTGG - Intergenic
1203688139 Un_GL000214v1:15452-15474 TAAAGATTGTATAAAATTTGTGG + Intergenic
1203602228 Un_KI270748v1:23794-23816 TAGATTTTGTATATAATGTGAGG + Intergenic
1203648136 Un_KI270751v1:88601-88623 TAAAGATTGTATAAAATTTGTGG - Intergenic
1186152720 X:6691468-6691490 TAGATGTGCAATAAAATATACGG + Intergenic
1186642279 X:11468510-11468532 TAGATTCAAAATAAAATTTGTGG - Intronic
1186680308 X:11866333-11866355 AAACTGTTAAATAAAATTTGTGG - Intergenic
1187179499 X:16930221-16930243 TAAAAATTGAATAAAATTTGTGG + Intergenic
1187411269 X:19052580-19052602 TATATGTAGCATATAATTTGTGG - Intronic
1187492953 X:19769597-19769619 AAGATGTTTAATACAATGTGTGG + Intronic
1187598942 X:20805511-20805533 AAGTTGTTGACTAAAAATTGGGG + Intergenic
1188116553 X:26251185-26251207 TAGATGTTGAACAGCATTTCTGG + Intergenic
1192394558 X:70766037-70766059 TAGATGTTTAATTTTATTTGTGG - Intronic
1193098350 X:77578860-77578882 TAGCTCTTGAATGGAATTTGTGG + Intronic
1193276339 X:79592656-79592678 CAGATTTGGATTAAAATTTGGGG + Intergenic
1193727180 X:85056441-85056463 TATATGTTTAAAAAAATTTTTGG + Intronic
1194107524 X:89789959-89789981 GAGATGTTGAATAGAATCTCAGG + Intergenic
1194844633 X:98789477-98789499 TACTTGTTGAAAAAAATTTCAGG - Intergenic
1195585186 X:106557045-106557067 TAGATGTTGAGAAAAATCTGTGG + Intergenic
1195989051 X:110664871-110664893 TAGAAGTTGGAGAACATTTGGGG - Intergenic
1196059968 X:111397607-111397629 AAGACATTAAATAAAATTTGGGG - Intronic
1196089739 X:111726841-111726863 AAGATGTTCAAGAAAATTCGAGG + Exonic
1196104115 X:111877919-111877941 TTGATGTAGATTAATATTTGAGG + Intronic
1196641036 X:118061154-118061176 TAAATCATAAATAAAATTTGTGG + Intronic
1197030835 X:121812888-121812910 TAGAGGAAGAAGAAAATTTGTGG + Intergenic
1198009543 X:132537123-132537145 GAGATTTTAAAAAAAATTTGTGG + Intergenic
1198090844 X:133328116-133328138 TAGATGTTTAAAAAAATCTCTGG - Intronic
1198161188 X:134010367-134010389 TAGGTGTTCAATAAACTTTCTGG + Intergenic
1198567844 X:137923255-137923277 TAAGTGTTCAATAAATTTTGCGG - Intergenic
1198588778 X:138152924-138152946 TAGAAGTTGGATATGATTTGGGG - Intergenic
1198614255 X:138437997-138438019 TAGATGTTTAATTGATTTTGGGG + Intergenic
1199121267 X:144056677-144056699 TAGATGCTGAATGGAAATTGAGG - Intergenic
1199363904 X:146955881-146955903 TAGAGGCTGAATAAAATATGAGG + Intergenic
1200128068 X:153826911-153826933 TAGAGATTGCATCAAATTTGTGG - Intronic
1200459482 Y:3437766-3437788 GAGATGTTGAATAGAATCTCAGG + Intergenic
1200972115 Y:9163809-9163831 TGAATGTTGAAGAAAATTTTTGG + Intergenic
1200972315 Y:9166146-9166168 TAAATGCTGAAGAAAATCTGGGG - Intergenic
1201906772 Y:19093473-19093495 TAGAAGTTGAACATATTTTGGGG + Intergenic
1202138708 Y:21698138-21698160 TAAATGCTGAAGAAAATCTGGGG + Intergenic