ID: 1169831561

View in Genome Browser
Species Human (GRCh38)
Location 20:9831038-9831060
Sequence TATCCCATGCCCAGTGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169831550_1169831561 3 Left 1169831550 20:9831012-9831034 CCTACTAATCAAGGCACCCCCCC 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1169831561 20:9831038-9831060 TATCCCATGCCCAGTGGGCTGGG 0: 1
1: 0
2: 2
3: 5
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169831561 Original CRISPR TATCCCATGCCCAGTGGGCT GGG Intronic
900237289 1:1598875-1598897 TAACCTAAGCCCAGTGGGGTGGG + Exonic
903014377 1:20352369-20352391 TCTCCCCTGCCCAGAGGCCTAGG + Intronic
903054664 1:20627208-20627230 TATCCCAAGGGCAGTGGGCAAGG + Intergenic
905474688 1:38217768-38217790 TCTCCCTTGGCCACTGGGCTGGG + Intergenic
905530342 1:38673562-38673584 TATCCCATCCCCAGCGAGCAAGG + Intergenic
906833466 1:49059146-49059168 TATCACAGGCCCAGAGGCCTAGG + Intronic
907896733 1:58699803-58699825 TGTCCCAAGCCCAGCGGGCAGGG - Intronic
908224652 1:62043931-62043953 TTGCCCATGCCCAGTCTGCTGGG + Intronic
909172741 1:72316445-72316467 TATCACATCCCCAGAGGGATTGG - Intergenic
909416834 1:75416142-75416164 TATCACAGGCCCAGAGGCCTAGG + Intronic
910327494 1:86027351-86027373 TATCACAGGCCCAGAGGCCTAGG + Intronic
911907499 1:103588559-103588581 TATCACAGGCCCAGAGGCCTGGG - Intergenic
912556463 1:110519769-110519791 GAAATCATGCCCAGTGGGCTTGG + Intergenic
912711560 1:111953732-111953754 TATTCCAGGCCCAGAGAGCTTGG + Intronic
917471517 1:175330027-175330049 TGTCCCATGCCCACTGTCCTTGG + Intronic
918264433 1:182828093-182828115 TATCCCCAGACCAGTGGGCTGGG + Intronic
918485896 1:185027724-185027746 CATCACAGGCCCAGTGGCCTAGG - Intergenic
920431853 1:205923830-205923852 TCTCCCCTGCCCTGTGGTCTGGG - Intronic
921213735 1:212920551-212920573 CATCCCAGGCTCAGAGGGCTGGG + Intergenic
921752146 1:218807950-218807972 TATTCCATTCCCAGTGGGGTGGG - Intergenic
1066544990 10:36489975-36489997 TAGGCCTTGCCCACTGGGCTTGG - Intergenic
1068439397 10:57032123-57032145 CATCACAGGCCCAGTGGCCTGGG + Intergenic
1071274088 10:84037017-84037039 TACCCCATGCCCAGAAGGCCAGG + Intergenic
1071384244 10:85103748-85103770 TTCCCCATGTCCAGTGGGCAGGG + Intergenic
1073447639 10:103590955-103590977 GCTGCCATGCCCAGTGGGCAGGG - Exonic
1074459538 10:113624740-113624762 TATGCCATGGCTGGTGGGCTTGG + Intronic
1075835409 10:125448694-125448716 CATCACAGGCCCAGTGGGGTGGG - Intergenic
1076453686 10:130574855-130574877 AATCCCATGCCCACTGGCCCGGG + Intergenic
1077426261 11:2479628-2479650 CATCCCAGGCCCAGAGGCCTAGG - Intronic
1078374981 11:10786062-10786084 CGTCTCATGCCCAGTGGCCTTGG - Intergenic
1079380253 11:19931863-19931885 CACCCCATGCCCAGTGTGCACGG - Intronic
1079445925 11:20556001-20556023 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1079772148 11:24475357-24475379 CATCACATGCCCAGAGGCCTAGG - Intergenic
1081745066 11:45467387-45467409 TATCTCAGGCCTTGTGGGCTAGG - Intergenic
1082756384 11:57080622-57080644 TATCCCATGACCATGGGGCAAGG + Intergenic
1084839740 11:71836073-71836095 TAGCACAAGGCCAGTGGGCTTGG + Intronic
1084876345 11:72136370-72136392 TTTCACATTCCCAGAGGGCTGGG + Intronic
1085941872 11:81214338-81214360 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1087255079 11:95944687-95944709 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1087692715 11:101340220-101340242 TATCCCAAGCCCAATGAGCTAGG - Intergenic
1088686696 11:112290073-112290095 CCTCCCAGGCCCAGTGGACTCGG + Intergenic
1092540311 12:9416483-9416505 TCTCTCAAGCCCAGTGAGCTGGG + Intergenic
1092593627 12:9975780-9975802 CATCACATGCCCAGAGGCCTAGG + Intronic
1093426370 12:19033031-19033053 CATCACAAGCCCAGTGGTCTAGG - Intergenic
1098075898 12:66730735-66730757 TTTCCCATGCCCAGTGTGCTGGG + Intronic
1101816371 12:108149172-108149194 TCTCCCTGGCCCAGTGGGATGGG + Intronic
1104766903 12:131335995-131336017 TGCCCCAAGCCCAGTGGGTTGGG + Intergenic
1105893492 13:24698925-24698947 GATGCCATGGCCACTGGGCTAGG - Intronic
1108095217 13:46894145-46894167 TGCCCCACGCCCCGTGGGCTGGG + Intronic
1110209009 13:72950913-72950935 TCCTACATGCCCAGTGGGCTGGG - Intronic
1110492339 13:76124403-76124425 TATCTCAGGCCCAGAGGCCTAGG + Intergenic
1111239622 13:85457501-85457523 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1111460855 13:88540171-88540193 AATCCCAGGCCCAGAGGCCTAGG + Intergenic
1112769653 13:102781752-102781774 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1113149918 13:107252094-107252116 CCTCCCATGCCCAGTGGGGGTGG - Intronic
1113405614 13:110036765-110036787 CATCCCATGTCCTGTGAGCTTGG + Intergenic
1113501917 13:110782399-110782421 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1114528433 14:23380463-23380485 TCTCCCATGCACACTGTGCTGGG + Intergenic
1114618869 14:24082814-24082836 TATTCCATGGCCAGGGGGCTGGG + Exonic
1115889626 14:38012202-38012224 TATCACAGGCCTAGTGGCCTAGG + Intronic
1116272152 14:42786046-42786068 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1116875797 14:50110512-50110534 TATCTCATACCCAGTGAGATGGG + Intronic
1118533380 14:66731782-66731804 CATCACAGGCCCAGTGGCCTAGG + Intronic
1119068819 14:71559447-71559469 TTTCCCCTGCCCAGTGGCATTGG + Intronic
1120132593 14:80824237-80824259 CATCACAAGCCCAGTGGCCTAGG - Intronic
1120485921 14:85113020-85113042 CATCACAGGCCCAGAGGGCTAGG - Intergenic
1122366742 14:101198844-101198866 AATGCCATGAGCAGTGGGCTTGG - Intergenic
1123931117 15:25172115-25172137 TGTCCTGTGCCCAGTGGTCTTGG + Intergenic
1123939796 15:25211309-25211331 TGTCCCATGCTCAGTGGTCCTGG + Intergenic
1127503405 15:59575700-59575722 TAACCCATTACCAGTGGACTGGG + Intergenic
1127695462 15:61442406-61442428 TATCTCATGCCCAGTTGGTCAGG - Intergenic
1129234923 15:74218272-74218294 TCACCCCTGCCCGGTGGGCTTGG + Intergenic
1129255238 15:74330559-74330581 TATCCCTTGGCCCGAGGGCTTGG - Intronic
1133006166 16:2883015-2883037 TATCCCAGCACCAGTGGGTTGGG - Intergenic
1134332019 16:13259836-13259858 TATCACAGGCCCAGAGGCCTGGG - Intergenic
1138089923 16:54165605-54165627 GTTCTCATGCCCAGTGGGTTTGG + Intergenic
1141765969 16:86060293-86060315 TTTGCCATGCCCTGTGGGGTGGG + Intergenic
1143322283 17:6075895-6075917 CCTCCCAGTCCCAGTGGGCTGGG + Intronic
1145041843 17:19582849-19582871 GAGGCCAGGCCCAGTGGGCTGGG + Intergenic
1146680018 17:34800345-34800367 TCTCCCAGGCCCAGTGGTCAGGG + Intergenic
1148460699 17:47837655-47837677 TATCCCAGGACCAGTGGGGGTGG - Exonic
1149902325 17:60491955-60491977 TATCACAGGCCCAGAGGCCTAGG + Intronic
1156892092 18:42202864-42202886 GAGCCCATGCCCAGTGTGCATGG - Intergenic
1158129693 18:54139365-54139387 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1160270395 18:77378430-77378452 CATCGCATGCCCTGTGGCCTGGG + Intergenic
1164477149 19:28584640-28584662 TCTACCTTTCCCAGTGGGCTGGG - Intergenic
1165399468 19:35588695-35588717 TATCCCTTGCCCCGTTGGCCGGG - Intergenic
1166075514 19:40411735-40411757 TTTCCCCTGCCTAGTGGGATAGG - Intronic
926806909 2:16719539-16719561 TATCTGATGCCCAGTGGCATAGG - Intergenic
926899696 2:17737108-17737130 TTTCCCATGCCCTATGGCCTTGG - Intronic
927613278 2:24563840-24563862 TATCCCACTTCCAGTGGCCTAGG + Intronic
929700253 2:44156536-44156558 TACCCACTGCCCAGTGGGATGGG - Intergenic
930060372 2:47283624-47283646 ACTCCCATGCCCATGGGGCTCGG - Intergenic
930438451 2:51376947-51376969 TATCACAGGCCCAGAGGCCTAGG + Intergenic
931703348 2:64926500-64926522 TATCACAAGCCCAGAGGCCTAGG + Intergenic
932772095 2:74506176-74506198 CATACCTTCCCCAGTGGGCTGGG + Exonic
932915661 2:75855643-75855665 TATCATATGCCCAGAGGCCTAGG + Intergenic
933070855 2:77856878-77856900 CATCACAGGCCCAGAGGGCTAGG + Intergenic
936636597 2:114265818-114265840 GCTCCCATGCCCAGTCTGCTAGG - Intergenic
938081066 2:128370404-128370426 TAGCCCAAGCCCACGGGGCTAGG - Intergenic
938366030 2:130735146-130735168 TATCCCTTGCTGAGTGGCCTTGG - Intergenic
939344795 2:140950292-140950314 CATCACAGGCCCAGTGGCCTGGG + Exonic
939498327 2:142949682-142949704 CATCACAAGCCCAGAGGGCTAGG - Intronic
939506947 2:143057217-143057239 CATCACATGCCCAGAGGCCTAGG - Intergenic
940621691 2:156121484-156121506 TATCACAGGCCCAGAGGCCTAGG + Intergenic
941578701 2:167268398-167268420 TATCACAGGCCCAGAGGCCTAGG + Intergenic
944027504 2:195189184-195189206 TATCCCATGCTCAGAGGCTTAGG - Intergenic
944160370 2:196653050-196653072 TATCACAGGCCCAGAGGCCTAGG - Intronic
946238879 2:218341896-218341918 CATCCCAGGCCCAAGGGGCTGGG - Intronic
948047255 2:234953467-234953489 AGTCCCCTTCCCAGTGGGCTGGG + Intronic
1169831561 20:9831038-9831060 TATCCCATGCCCAGTGGGCTGGG + Intronic
1173480195 20:43392723-43392745 AATTCCATGCCCTGTGGGCGGGG - Intergenic
1174266436 20:49335576-49335598 CACCCCATGCCCAGTGGACAAGG + Intergenic
1174447960 20:50602879-50602901 TTGCTCATGCCCTGTGGGCTGGG + Intronic
1177599186 21:23288920-23288942 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1178154248 21:29832716-29832738 TGTCACAGGCCCAGAGGGCTGGG - Intronic
1179278311 21:39911664-39911686 TATCCCATTGCCATGGGGCTGGG - Intronic
1179296335 21:40066074-40066096 CCTCCCATGCCCAGTAGGCAGGG + Intronic
1181533240 22:23529075-23529097 CATCGCATGCCCTGTGCGCTAGG + Intergenic
1181748779 22:24974453-24974475 TAGCCCATGGTCAGTCGGCTAGG + Intronic
1182071639 22:27467724-27467746 AATCCAATGCCCAGTGGGCTTGG - Intergenic
1184649954 22:45915186-45915208 CCTGCCAGGCCCAGTGGGCTAGG - Intergenic
953184929 3:40629156-40629178 TATCACAGGCCCAGAGGCCTAGG + Intergenic
953623535 3:44552490-44552512 ACTCCCATTCACAGTGGGCTGGG + Intergenic
954421123 3:50419539-50419561 CATCCTATGACCATTGGGCTCGG + Intronic
956360173 3:68438974-68438996 CATCACAGGCCCAGGGGGCTAGG - Intronic
956511883 3:70001850-70001872 TACCTGATGCCCAGTGGTCTAGG + Intergenic
959283607 3:104379498-104379520 TGTCACATGCCCAGAGGTCTGGG + Intergenic
959769169 3:110072187-110072209 TATCACAGGCCCAGAGGCCTAGG + Intergenic
963404461 3:144844429-144844451 TATCACAGGCCCAGAGGCCTAGG - Intergenic
963815898 3:149830809-149830831 TATCACACGCCCAGAGGCCTAGG + Intronic
964279906 3:155052668-155052690 TATCACAGGCCCAGAGGCCTAGG - Intronic
964662823 3:159139663-159139685 GATCCCAGGAGCAGTGGGCTGGG + Intronic
964919996 3:161884983-161885005 CATCACAGGCCCAGTGGACTAGG + Intergenic
965323341 3:167273356-167273378 CAGCCCATGCCCAGTTGACTGGG - Intronic
965386849 3:168056051-168056073 TATCACAGGCCCAGAGGCCTAGG + Intronic
969780826 4:9402081-9402103 TAGCACAAGGCCAGTGGGCTTGG + Intergenic
971248850 4:24954723-24954745 TATCACAGGCCCAGAGTGCTAGG - Intronic
971545502 4:27880269-27880291 TATCACAGGCCCAGAGGCCTAGG - Intergenic
972102934 4:35445487-35445509 TATCACAGGCCCAGAGGTCTAGG + Intergenic
973032343 4:45360455-45360477 TATCACAGGCCCAGAGGCCTAGG + Intergenic
974255168 4:59443072-59443094 CATCCCATGGCAAGGGGGCTGGG - Intergenic
974492844 4:62588909-62588931 TATCACAGGCCCAGAGGCCTAGG - Intergenic
975758435 4:77594561-77594583 AATCCCAGGCACAGTGGCCTGGG + Intronic
976442227 4:85088947-85088969 TATCACAGGCCCAGAGGCCTAGG + Intergenic
977301580 4:95273793-95273815 TCTCCCACTCCCAGTGGCCTTGG + Intronic
979177100 4:117679062-117679084 CATCACAGGCCCAGAGGGCTAGG + Intergenic
983287701 4:165760559-165760581 TATCCTTTGCTCAGTGGGCAAGG + Intergenic
983437188 4:167730929-167730951 TATCACAGGCCCAGAGGCCTAGG + Intergenic
983713919 4:170754344-170754366 TATCACAGGCCCAGAGGCCTAGG + Intergenic
986901859 5:12445099-12445121 AGTCCCATGCCCAGTGGGAATGG + Intergenic
987470107 5:18317526-18317548 TTTCCCATGCCCAGTGCCCAAGG + Intergenic
988520532 5:31941309-31941331 TATCCCATGGGCAGTCGTCTGGG - Intronic
990264506 5:54061092-54061114 TATCACAGGCCCAGAGGTCTAGG + Intronic
993517486 5:88856542-88856564 TATCACAGGCCCAGAGGCCTAGG + Intronic
995132712 5:108647466-108647488 TATCACAGGCCCAGAGGCCTAGG + Intergenic
996027049 5:118657815-118657837 TATCACAGGCCCAGAGGCCTAGG - Intergenic
996567700 5:124897503-124897525 TATTCCATGGCCTGGGGGCTGGG - Intergenic
996611188 5:125382419-125382441 TATCACAGGCCCAGAGTGCTAGG + Intergenic
997429522 5:133827922-133827944 TCTCTCCTGCCCAGGGGGCTGGG - Intergenic
997754824 5:136386517-136386539 TATCCCATGACTAATGGACTTGG + Intronic
998487644 5:142517153-142517175 TATCACAGGCCCAGAGGCCTAGG + Intergenic
999238514 5:150114172-150114194 CCTCCAATGCCCACTGGGCTGGG + Exonic
1001703255 5:173722572-173722594 TAGCCAATGGGCAGTGGGCTGGG - Intergenic
1003934230 6:10958933-10958955 TATCTCATGACCACTGTGCTAGG + Intronic
1004131923 6:12928743-12928765 TCTGCCTTGCCCAGGGGGCTGGG - Intronic
1004265710 6:14146729-14146751 TAGCACTTGCTCAGTGGGCTTGG - Intergenic
1004335806 6:14763313-14763335 ATTCACATGCCCAGTGGACTTGG + Intergenic
1005070447 6:21857525-21857547 TATCCTATACCCAGTGGGTCAGG - Intergenic
1007258140 6:40542785-40542807 GAGCCCATCCCCAGAGGGCTGGG + Intronic
1008681504 6:53877304-53877326 TATCACAGGCCCAGAGGCCTAGG - Intronic
1008848234 6:55993899-55993921 TATCACATGCCCAGATGCCTTGG - Intergenic
1009559472 6:65221303-65221325 CATCACATGCCCAGAGGCCTAGG + Intronic
1011845694 6:91560703-91560725 TATCACAGGCCCAGAGGCCTTGG - Intergenic
1012210180 6:96509713-96509735 CATCACATGCCCAGAGGCCTAGG + Intergenic
1012756620 6:103240230-103240252 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1012897707 6:104969983-104970005 TATCCAATGTCCAGTGTGATGGG - Intronic
1014037460 6:116783884-116783906 TATCCCATTGTCAGTGGGCATGG - Intergenic
1015045224 6:128768412-128768434 CATCACAGGCCCAGTGGTCTAGG - Intergenic
1016729143 6:147408677-147408699 TATCATATGCCCAGAGGGCGTGG - Intergenic
1019081580 6:169434944-169434966 TATCACAAGCCCAGAGGTCTAGG + Intergenic
1020288386 7:6703940-6703962 TATCCCATAGCCTGTGGTCTTGG - Intronic
1020687487 7:11313652-11313674 ATTCCCATCCCCAGTGGGATGGG + Intergenic
1021603793 7:22390993-22391015 TATGCCATGCTCTGTGAGCTTGG - Intergenic
1024015291 7:45308172-45308194 TATCCCAGGCCTAGAGGCCTGGG + Intergenic
1028314455 7:89383476-89383498 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1028360061 7:89956258-89956280 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1029306280 7:99622379-99622401 TTTCCCATGCACAGGGGCCTGGG - Intronic
1030754718 7:113273318-113273340 TATCACAAGCCCAGAGGCCTAGG - Intergenic
1030904323 7:115163314-115163336 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1031618290 7:123905926-123905948 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1033031639 7:137832600-137832622 TATCACAGGCCCAGCGGCCTAGG - Intronic
1033483054 7:141760597-141760619 TATCACAGGCCCAGAGGTCTTGG - Intronic
1034739637 7:153462260-153462282 CATCCCAGGCCCAGAGGCCTAGG + Intergenic
1035171670 7:157020848-157020870 TATCCCAGAACCACTGGGCTGGG - Intergenic
1036278259 8:7376014-7376036 TAGCACAAGGCCAGTGGGCTTGG + Intronic
1036343263 8:7935876-7935898 TAGCACAAGGCCAGTGGGCTTGG - Intronic
1036391945 8:8331172-8331194 CATCCCAAGTCCAGTCGGCTAGG + Intronic
1036708518 8:11062242-11062264 TATCACATGCCAAGAGGCCTGGG + Intronic
1036838597 8:12096639-12096661 TAGCACAAGGCCAGTGGGCTTGG - Intergenic
1036860386 8:12342883-12342905 TAGCACAAGGCCAGTGGGCTTGG - Intergenic
1037493985 8:19421405-19421427 CATTCCATGCCCAGTGGGACAGG + Intronic
1037778605 8:21852064-21852086 TAGCCCACTCCCAGTGGGCCTGG + Intergenic
1038387547 8:27163413-27163435 TATCCAATGCCCAGTGTGCCAGG - Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1043872981 8:85455588-85455610 TATTTCATGCCCAGTGTGTTGGG - Intergenic
1045785708 8:105918384-105918406 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1050255571 9:3789184-3789206 CATCACAGGCCCAGAGGGCTAGG + Intergenic
1056695408 9:88846272-88846294 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1057216434 9:93231316-93231338 TATCCCAGCCCAAGTGGTCTGGG - Intronic
1061969425 9:134035847-134035869 TCACCCAGGGCCAGTGGGCTTGG - Intronic
1062495329 9:136828820-136828842 TATCCCAGTCTCGGTGGGCTCGG + Intronic
1188962410 X:36508258-36508280 CATCACAGGCCCAGAGGGCTAGG - Intergenic
1190153318 X:47966752-47966774 CATCACAAGCCCAGAGGGCTAGG + Intronic
1190755693 X:53399932-53399954 TATGCCATGTCCACAGGGCTAGG - Intronic
1190794058 X:53725033-53725055 CATCACAGGCCCAGAGGGCTAGG + Intergenic
1193731353 X:85107596-85107618 TGTCTCATGCCTAGTTGGCTGGG + Exonic
1194497427 X:94635164-94635186 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1195196041 X:102498909-102498931 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1197392341 X:125883326-125883348 CATCACAGGCCCAGAGGGCTAGG + Intergenic
1197581856 X:128294056-128294078 TATCTCAGGCCCAGAGGCCTAGG + Intergenic
1200345303 X:155441315-155441337 CATCACAGGCCCAGTGGCCTAGG - Intergenic