ID: 1169832557

View in Genome Browser
Species Human (GRCh38)
Location 20:9839738-9839760
Sequence CTGGCTAGTAAGCCAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169832553_1169832557 23 Left 1169832553 20:9839692-9839714 CCAGGGGAAGAAGGATTCCTGGA No data
Right 1169832557 20:9839738-9839760 CTGGCTAGTAAGCCAGTTGCTGG No data
1169832554_1169832557 6 Left 1169832554 20:9839709-9839731 CCTGGACCTTTTCATGCTCACTT No data
Right 1169832557 20:9839738-9839760 CTGGCTAGTAAGCCAGTTGCTGG No data
1169832555_1169832557 0 Left 1169832555 20:9839715-9839737 CCTTTTCATGCTCACTTTGCTAG No data
Right 1169832557 20:9839738-9839760 CTGGCTAGTAAGCCAGTTGCTGG No data
1169832551_1169832557 24 Left 1169832551 20:9839691-9839713 CCCAGGGGAAGAAGGATTCCTGG No data
Right 1169832557 20:9839738-9839760 CTGGCTAGTAAGCCAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169832557 Original CRISPR CTGGCTAGTAAGCCAGTTGC TGG Intergenic
No off target data available for this crispr