ID: 1169845850

View in Genome Browser
Species Human (GRCh38)
Location 20:9990720-9990742
Sequence CTTTAGTTCTTTATGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 1, 2: 7, 3: 71, 4: 709}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169845850_1169845855 4 Left 1169845850 20:9990720-9990742 CCATTTTACATAAAGAACTAAAG 0: 1
1: 1
2: 7
3: 71
4: 709
Right 1169845855 20:9990747-9990769 CTTAGATTTTGGCACCACTGGGG 0: 1
1: 0
2: 1
3: 15
4: 118
1169845850_1169845852 2 Left 1169845850 20:9990720-9990742 CCATTTTACATAAAGAACTAAAG 0: 1
1: 1
2: 7
3: 71
4: 709
Right 1169845852 20:9990745-9990767 TCCTTAGATTTTGGCACCACTGG 0: 1
1: 0
2: 0
3: 12
4: 192
1169845850_1169845851 -7 Left 1169845850 20:9990720-9990742 CCATTTTACATAAAGAACTAAAG 0: 1
1: 1
2: 7
3: 71
4: 709
Right 1169845851 20:9990736-9990758 ACTAAAGTATCCTTAGATTTTGG 0: 1
1: 0
2: 4
3: 66
4: 449
1169845850_1169845856 11 Left 1169845850 20:9990720-9990742 CCATTTTACATAAAGAACTAAAG 0: 1
1: 1
2: 7
3: 71
4: 709
Right 1169845856 20:9990754-9990776 TTTGGCACCACTGGGGATCCTGG 0: 1
1: 0
2: 1
3: 20
4: 170
1169845850_1169845854 3 Left 1169845850 20:9990720-9990742 CCATTTTACATAAAGAACTAAAG 0: 1
1: 1
2: 7
3: 71
4: 709
Right 1169845854 20:9990746-9990768 CCTTAGATTTTGGCACCACTGGG 0: 1
1: 0
2: 1
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169845850 Original CRISPR CTTTAGTTCTTTATGTAAAA TGG (reversed) Intronic
901696268 1:11010510-11010532 CTTTATTTATTTATTTAAGATGG - Intergenic
901950726 1:12743816-12743838 ATTTGGTTCTTTATGTCAAAAGG - Intergenic
902231908 1:15033159-15033181 CTCAAGTCCTTTATATAAAATGG - Intronic
902356235 1:15903140-15903162 ATGTAGTTCTGTTTGTAAAATGG + Intronic
902425527 1:16318411-16318433 CTTTATTTATTTATTTAAGACGG - Intronic
902851275 1:19159345-19159367 CTTTAGTTTTTCATGTCACATGG - Intronic
903095494 1:20968851-20968873 TTCAAGTTCATTATGTAAAATGG - Intronic
903407792 1:23113083-23113105 TTCTAGTTCTTTATGTAATTTGG - Intronic
903527640 1:24004239-24004261 CTTTATTTATTTATTTAAGATGG + Intergenic
903967031 1:27097284-27097306 CTCAAGTTCCTGATGTAAAATGG - Intergenic
904109435 1:28113959-28113981 TTATTATTCTTTATGTAAAAAGG - Intergenic
904176300 1:28631663-28631685 CTTTATTTATTTATTTTAAAGGG + Intronic
904766235 1:32849977-32849999 CTTTATTTATTTATTTAAACAGG + Intronic
904926423 1:34052412-34052434 CTTAAGTCCCTTATTTAAAATGG - Intronic
905852543 1:41284791-41284813 CTTTTTTTCTTTAAATAAAAGGG - Intergenic
905905249 1:41613569-41613591 CTTTAATTCCTTCTGAAAAAAGG + Intronic
905910675 1:41651597-41651619 CTCAAGTCCTTTATATAAAATGG - Intronic
906174054 1:43754034-43754056 CTTTATTTCTCACTGTAAAAAGG + Intronic
906860727 1:49356259-49356281 CATGACTTCTTTTTGTAAAAAGG + Intronic
907420949 1:54346925-54346947 CTTGAGTCCTTTACATAAAATGG + Intronic
907752767 1:57279228-57279250 TTCAAGTTCTTTATATAAAATGG + Intronic
908022369 1:59911428-59911450 CTTTAGTTTTTTAACTAATATGG - Intronic
908056419 1:60292059-60292081 ACTTAGGTCTTTATGTAAAAGGG - Intergenic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
908374014 1:63515142-63515164 TTTTAGTCCTAAATGTAAAAAGG - Intronic
908822141 1:68099544-68099566 CTCAAGTCCCTTATGTAAAATGG + Intronic
909524177 1:76604188-76604210 CTTGTGTTCTTTATGTACAGAGG - Intronic
909644924 1:77906277-77906299 CTTCAGTTTTATATGTAAAATGG - Intronic
909650912 1:77974942-77974964 CTCAAGTTCCTTATATAAAATGG + Intronic
909771894 1:79433875-79433897 CTTGAGTTTTATATGTATAATGG - Intergenic
909786998 1:79625910-79625932 ATTTAGTTCATTATGTAATGTGG + Intergenic
910316586 1:85891429-85891451 TTTTAGTTTTTAAGGTAAAATGG - Intronic
910578400 1:88793686-88793708 CTCAAGTCCTTTATATAAAATGG + Intronic
911763680 1:101646571-101646593 CTCAAGTCCTTTATATAAAATGG + Intergenic
912072367 1:105827336-105827358 CTTAAGCCCTTTAGGTAAAATGG + Intergenic
912355516 1:109051920-109051942 TTTCAGTTATTTATCTAAAATGG + Intergenic
912629185 1:111231884-111231906 ATTTAGCTCTTGATGTAAATGGG - Intronic
912870125 1:113296164-113296186 CATTAGATCTCTATATAAAAAGG - Intergenic
913050249 1:115111187-115111209 CTCAAGTCCCTTATGTAAAATGG + Intergenic
913281863 1:117193139-117193161 CTCAAGTTCCTTATATAAAATGG - Intronic
913304625 1:117414594-117414616 TTTTAATTATTTATGTATAAAGG - Intronic
913460028 1:119075360-119075382 CTCAAGTTCCTTATATAAAATGG - Intronic
914436515 1:147665093-147665115 CTTTAGATTTGTATGTATAAAGG + Intronic
916227687 1:162506238-162506260 ATTTAGTATTCTATGTAAAATGG - Intronic
916302059 1:163286279-163286301 CTCAAGTCCCTTATGTAAAATGG - Intronic
916755382 1:167764527-167764549 CTTAAGTTCTTTATAAGAAAAGG + Intronic
916808926 1:168288140-168288162 CTGAAGTTCCTTATATAAAATGG + Intronic
917031488 1:170697281-170697303 CATTAGTTACTTTTGTAAAATGG + Intronic
917652584 1:177093576-177093598 CTTTTGCCCTTTGTGTAAAAAGG + Intronic
917877851 1:179302883-179302905 CTTTAATTCTTTATTGTAAATGG + Intronic
918494684 1:185121530-185121552 CTTTATGTTTTTATGTAAAGAGG - Intronic
918910940 1:190568638-190568660 CTGTAGTTCTGTTTTTAAAAAGG + Intergenic
919444084 1:197679504-197679526 CTTAAGTCCTTTATATAAAATGG - Intronic
919517426 1:198544211-198544233 ATTTATTTCTTCATTTAAAATGG - Intergenic
919833620 1:201558982-201559004 CTTTAGTTCAGCATGTCAAAAGG + Intergenic
920886038 1:209929001-209929023 CTTAAGTTCTTTATATAAAATGG - Intergenic
921142130 1:212318881-212318903 CTCAAGTCCCTTATGTAAAATGG - Intronic
921158666 1:212457575-212457597 TTTGAGTCCTTTCTGTAAAAAGG - Intergenic
921270759 1:213467489-213467511 CAAAAGTTCTTTATGTAAATGGG + Intergenic
921318912 1:213918428-213918450 CATTTGCTCTTTATTTAAAAGGG - Intergenic
921712208 1:218384424-218384446 TTTTAGTACTTTATTTTAAAAGG - Intronic
921821262 1:219619768-219619790 CTTAATTTCCTAATGTAAAATGG - Intergenic
922003038 1:221500366-221500388 CTCAAGTACTTTATATAAAATGG + Intergenic
922283497 1:224147583-224147605 CTCAAGTCCTTTATATAAAATGG - Intronic
923173366 1:231438390-231438412 CTCAAGTTCCTTATATAAAATGG - Intergenic
923646075 1:235821633-235821655 ATCTGGTTCTTTATATAAAAAGG - Intronic
923926448 1:238633165-238633187 CTCAAGTCCTTTATATAAAATGG + Intergenic
924085384 1:240446143-240446165 ATTTAGTTCTTTTTAAAAAATGG + Intronic
924166331 1:241287131-241287153 CTGAAGTTCATTATGTTAAAGGG - Intronic
924245702 1:242082107-242082129 TTGTAGTTATTTATATAAAAAGG - Intergenic
924357695 1:243200194-243200216 CTCAAGTTCCTTATGTAAAATGG - Intronic
1063259236 10:4366498-4366520 GTTTAGTTTTTTATGGAGAAGGG + Intergenic
1063633657 10:7759387-7759409 CTTAAATCCTTTATGAAAAAAGG + Intronic
1063649606 10:7919612-7919634 CTCAAGTCCCTTATGTAAAATGG + Intronic
1063759820 10:9060744-9060766 CTTTAGCTCTGAATGTAGAAGGG + Intergenic
1063862777 10:10329911-10329933 CTTCAGTAATCTATGTAAAAGGG - Intergenic
1063991466 10:11569078-11569100 TTGTAGTTCTTTATTTACAAAGG - Intronic
1064244029 10:13655357-13655379 CGTTGGTTCTTTATCTAATAGGG + Exonic
1066230659 10:33429595-33429617 TATTATTTCTTTATGCAAAATGG - Intergenic
1066289773 10:34003110-34003132 CTTCAGTTCATCATGTCAAAGGG + Intergenic
1066622891 10:37376759-37376781 CTTTAGCTCAGTATGTAGAAAGG - Intronic
1066755307 10:38705660-38705682 CTTTGGTTCTTTTTGTAAGCTGG + Intergenic
1067000834 10:42611546-42611568 TTTTGGTACTTTATCTAAAAGGG - Intronic
1067925515 10:50504502-50504524 CTTAACTTCTTTCTTTAAAATGG - Intronic
1067973301 10:50994989-50995011 CTCAAGTCCTTTATATAAAATGG - Intronic
1068447696 10:57144146-57144168 CTTGAGTTCTTGATATATAATGG - Intergenic
1068481853 10:57599842-57599864 CTTCAGTTTTTTTTTTAAAATGG + Intergenic
1068905368 10:62316293-62316315 CTTAAGTCCTTGATATAAAATGG - Intergenic
1069266106 10:66459935-66459957 TTTTGGTTCTTTATTTTAAATGG + Intronic
1069346284 10:67474187-67474209 CTCAAGTCCTTTATATAAAATGG - Intronic
1069533492 10:69236073-69236095 CTTTAGAACTTCATTTAAAATGG + Intronic
1069570248 10:69490337-69490359 CTCAAGTCCTTTATATAAAATGG + Intronic
1070160250 10:73862417-73862439 CTAGAGTTCTTTCTGTAAACAGG + Intronic
1070271026 10:74955066-74955088 CTCAAGTCCCTTATGTAAAATGG + Intronic
1070659797 10:78296743-78296765 CTCAAGTCTTTTATGTAAAATGG + Intergenic
1070978512 10:80625368-80625390 CTTAAGTTCTTTATGTAAAATGG + Intronic
1071030677 10:81176779-81176801 CTTAAGTTCCTTATATAAAATGG - Intergenic
1071174458 10:82908461-82908483 CTTTAATTCATTGTGTTAAATGG + Intronic
1071758833 10:88577104-88577126 CCTTAGTTCTTTATGCAACCTGG - Intronic
1071886630 10:89958374-89958396 CCTTAGTTAATTATGTAAGAGGG + Intergenic
1072103139 10:92248135-92248157 AGTAAGTTCCTTATGTAAAATGG + Intronic
1072179765 10:92970427-92970449 CTGAAGTCCTTTATATAAAATGG - Intronic
1072301749 10:94068531-94068553 CTTAAGTTCCTTATATAAAATGG - Intronic
1073619525 10:105032186-105032208 CTTTCTTTCTTTTTTTAAAATGG - Intronic
1074464576 10:113669873-113669895 CTCAAGTTCCTTATATAAAATGG + Intergenic
1075503799 10:123003381-123003403 CTCCAGTCCTTTATATAAAATGG - Intronic
1076080652 10:127577647-127577669 CTTTTTTTCTTCATTTAAAAAGG + Intergenic
1076341541 10:129750680-129750702 CTTAAGTTCCTGATATAAAATGG - Intronic
1076548051 10:131259376-131259398 TTTTAGTTCTTCATGTGAGATGG - Intronic
1076775375 10:132693427-132693449 CTTTAGGTGTTTATATAAATGGG - Intronic
1078107042 11:8365088-8365110 CTTTCCTTCTATCTGTAAAATGG - Intergenic
1078212678 11:9283439-9283461 CTTTAGTTTTTTTTGGAAGATGG + Exonic
1078231363 11:9445972-9445994 CTTGAATTCGGTATGTAAAAAGG + Exonic
1078306590 11:10194395-10194417 CTCAAGTTCCTTATATAAAATGG - Intronic
1078813148 11:14791813-14791835 CTTGAGTCCTTTATATAAAATGG + Intronic
1078842680 11:15092972-15092994 CTTTTGTTATTTTTGTTAAAAGG + Intergenic
1078955559 11:16190563-16190585 CTCAAGTTCCTTATGTAAAATGG - Intronic
1079619595 11:22537031-22537053 TTTTAGTTAGTTGTGTAAAAAGG + Intergenic
1079968338 11:27005974-27005996 TTTTAGTTCAAAATGTAAAAGGG - Intergenic
1080826678 11:35854536-35854558 CTTAAGTCCCTTATATAAAATGG - Intergenic
1080913792 11:36633750-36633772 CTCTAATTCTCTGTGTAAAATGG + Intronic
1080999980 11:37656643-37656665 CTCAAGTTTCTTATGTAAAATGG - Intergenic
1081104893 11:39054162-39054184 CTCAAGTACTTTTTGTAAAATGG - Intergenic
1081403290 11:42667284-42667306 CTTTAGTTGTCTATCTCAAAGGG - Intergenic
1081445291 11:43125367-43125389 CTTCAGTTTTTAATGTAAAAGGG - Intergenic
1081833852 11:46137271-46137293 CTTTATTTCTTCATGGAAAGTGG + Intergenic
1082189234 11:49222479-49222501 CTCAAGTCCCTTATGTAAAATGG + Intergenic
1082892431 11:58154240-58154262 CTTAATTTCTTTATGCACAAGGG - Intronic
1085718378 11:78892521-78892543 CTTATGTTCTTCATGTAAAAAGG + Intronic
1085772314 11:79336626-79336648 CATTACTTCTATCTGTAAAATGG + Intronic
1086242772 11:84715912-84715934 CTTTGGTTATATATCTAAAAGGG + Intronic
1086253294 11:84843593-84843615 CTCAAGTCCTTTATATAAAATGG + Intronic
1086650917 11:89288964-89288986 CTTAAGTGGTTTCTGTAAAAAGG + Intronic
1086677288 11:89624118-89624140 CTCAAGTCCCTTATGTAAAATGG - Intergenic
1086797778 11:91130002-91130024 CCTTAGTTATCTATTTAAAAAGG - Intergenic
1087176999 11:95105273-95105295 CTCAAGTCCCTTATGTAAAATGG + Intronic
1087326504 11:96729574-96729596 CTTTAGTTCAATATTTAAATGGG + Intergenic
1087382289 11:97421876-97421898 CTTTAGTGTTTTATCAAAAAAGG + Intergenic
1087600138 11:100304065-100304087 CTGGAGTTCTTCATGTAATATGG - Intronic
1087622034 11:100553805-100553827 ATTTGGCTCTTTATGTTAAAAGG - Intergenic
1087770142 11:102200341-102200363 CTATAGTTTTTTAATTAAAATGG + Intronic
1088912420 11:114201706-114201728 CTTTAGTATTTTATATGAAATGG - Intronic
1089208801 11:116787347-116787369 CCTTAGTTTCTTTTGTAAAATGG - Intronic
1089279830 11:117366063-117366085 ATTTAGTTCTTTTTGTCACATGG + Intronic
1089828417 11:121301066-121301088 TTTTAATTTTTTATGGAAAATGG - Intronic
1089880719 11:121770731-121770753 CTACAGTTCTTTAAATAAAATGG + Intergenic
1091093645 11:132796128-132796150 CTCAAGTTCTTGATATAAAATGG - Intronic
1091872200 12:3903165-3903187 CTCAAGTTCCTTATATAAAATGG + Intergenic
1092486283 12:8905006-8905028 TTATAATTCTTTGTGTAAAAAGG + Intergenic
1092887059 12:12934084-12934106 ATTTGGCTCTTTATGTCAAAAGG + Intergenic
1093327298 12:17793283-17793305 CTTTTGTGCATTATGTATAATGG - Intergenic
1093327300 12:17793319-17793341 CTTTTGTGCATTATGTATAATGG - Intergenic
1093587439 12:20856869-20856891 CTCAAGTCCTTTAGGTAAAAAGG - Intronic
1093756216 12:22854949-22854971 TTATAGTTCTTTATATGAAAGGG - Intergenic
1093763938 12:22941097-22941119 CTTTAGCACTTTTTGTAACATGG + Intergenic
1093897294 12:24588599-24588621 CTCAAGTTCCTTATATAAAATGG + Intergenic
1094370376 12:29731180-29731202 GTTTATTTATTTATATAAAAAGG + Intronic
1094610205 12:31988497-31988519 CTTAAGTTCCTTATGTAAAATGG - Intronic
1094618591 12:32058768-32058790 CTCAAGTTCCTTATATAAAATGG - Intergenic
1095342015 12:41101281-41101303 CTCAAGTTCCTTATATAAAATGG - Intergenic
1095365843 12:41404002-41404024 CTGAAGTTCTTTATATAAAATGG + Intronic
1095537221 12:43264161-43264183 ATTAAATTGTTTATGTAAAAGGG + Intergenic
1095667709 12:44821459-44821481 TTTTAGTTCTTTAAGTAAGTAGG + Intronic
1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG + Intronic
1097574108 12:61369961-61369983 TTTGAGTTCTATATTTAAAAAGG + Intergenic
1097655609 12:62358878-62358900 CTCAAGTTCTTGATATAAAATGG - Intronic
1098083824 12:66819610-66819632 TTTTAGTTTTATATGTCAAAAGG + Intergenic
1098360400 12:69648849-69648871 ATTTGGTACTTTATGTAGAAAGG - Intronic
1098508280 12:71281260-71281282 CTCAAGTTCCTGATGTAAAATGG - Intronic
1099852615 12:88121515-88121537 ATTTAGTTCTTTATTTCAAATGG - Intronic
1100782538 12:98044506-98044528 CTTAAGTCTTTTATTTAAAATGG + Intergenic
1100812954 12:98357956-98357978 CTTTAAAGCATTATGTAAAATGG - Intergenic
1101341207 12:103842542-103842564 CTCAAGTCCTTTATATAAAATGG + Intronic
1102836313 12:116063875-116063897 CTTAAGTGCCTTATATAAAATGG + Intronic
1103429560 12:120871450-120871472 CTAAAGTCCTTTATATAAAATGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1103966819 12:124645428-124645450 CTTCAGTTCCATCTGTAAAATGG - Intergenic
1104469745 12:129020006-129020028 CTTTCTTTCTTTTTGTAAATAGG + Intergenic
1105276698 13:18935618-18935640 CTTTAGTTTCCTATATAAAATGG + Intergenic
1105825759 13:24121259-24121281 CTTGAATTCGGTATGTAAAAAGG - Intronic
1106293100 13:28383922-28383944 CTCAAGTTCCTTATATAAAATGG - Intronic
1106368718 13:29110069-29110091 CATGATTTCTTTATTTAAAAAGG + Intronic
1106543032 13:30706893-30706915 ATTTGGCTCTTTATGTTAAAAGG + Intergenic
1106847252 13:33749405-33749427 CTCAAGTTCCTTATATAAAATGG - Intergenic
1106969746 13:35124897-35124919 CTTTATCTCTTAATATAAAAAGG - Intronic
1107324579 13:39227573-39227595 CTCTAGCTCTTCATGTAGAAAGG + Intergenic
1107535955 13:41332364-41332386 CTTTTGTACTTTATATAAATAGG + Intronic
1107566444 13:41610190-41610212 GTTTAGTTCTTTTTCTAAATGGG + Intronic
1107748321 13:43536909-43536931 CCTTGGTTTTTTATGTAAATTGG - Intronic
1107914933 13:45139908-45139930 CTCAAGTCCTTTATATAAAATGG + Intronic
1109135289 13:58641728-58641750 CTTTGTGTTTTTATGTAAAATGG - Intergenic
1109226784 13:59706051-59706073 CTCTAGTCCTTGATATAAAATGG + Intronic
1109265209 13:60190796-60190818 TTTTAGTTCTTTGTGTTACATGG - Intergenic
1109415881 13:62039390-62039412 CTTTAATTCTATATAGAAAAGGG + Intergenic
1109450758 13:62511814-62511836 GTTTAGTTCTTTCTTAAAAAAGG + Intergenic
1109481505 13:62961514-62961536 CTTAAGTCCTTAATATAAAATGG - Intergenic
1109513378 13:63408117-63408139 CTTTAGATCTTTTAGAAAAAAGG - Intergenic
1109668207 13:65566799-65566821 CTGAAGTTCTTAATATAAAATGG + Intergenic
1109693273 13:65921084-65921106 CTTTGGTGCTATATCTAAAAAGG - Intergenic
1110145501 13:72185654-72185676 ATTTAGTTTTTCATGAAAAATGG - Intergenic
1110467643 13:75820643-75820665 CTTGACTTCTTTAATTAAAATGG - Intronic
1110510674 13:76346455-76346477 CTTTAGTTCTGTGTGTATGATGG - Intergenic
1110780060 13:79455038-79455060 ATTTTGTTGTTTATGTCAAAAGG + Intergenic
1110859233 13:80329159-80329181 TTTTGGTTGTTCATGTAAAAGGG + Intergenic
1110923442 13:81119161-81119183 TTATTTTTCTTTATGTAAAAAGG - Intergenic
1111517812 13:89357932-89357954 TTTTAGTTCTATATCAAAAATGG - Intergenic
1111547854 13:89767290-89767312 CTCAAGTTCTTTGTATAAAATGG + Intergenic
1111548637 13:89778845-89778867 CTCAAGTCCTTTATGTAAAATGG - Intergenic
1112062759 13:95757534-95757556 CTTAAGTTCATTGGGTAAAAAGG - Intronic
1112642853 13:101296584-101296606 TTTTAGTTCTATAATTAAAATGG - Intronic
1114081184 14:19202326-19202348 GTGTATTCCTTTATGTAAAATGG - Intergenic
1114087342 14:19243176-19243198 CTTTATTTATTTATTTAAGATGG - Intergenic
1114529229 14:23385103-23385125 CTTTAATTCTTTCTGGAGAAAGG - Intronic
1114676736 14:24445893-24445915 CTTCAGTTAATAATGTAAAAAGG + Intergenic
1114917182 14:27283492-27283514 CTTTAGCTCTTTTTATAGAATGG - Intergenic
1115061677 14:29199185-29199207 TTTTAGTTTTTCATTTAAAAAGG + Intergenic
1115101712 14:29709226-29709248 ATTTATTTCCTTAAGTAAAAGGG + Intronic
1115116964 14:29892308-29892330 CTTGAGTTCTTTAAAGAAAATGG - Intronic
1115123388 14:29964407-29964429 GTTTACTTCTTTATCTGAAAGGG - Intronic
1115188529 14:30720772-30720794 CTCAAGTACCTTATGTAAAATGG - Intronic
1115913076 14:38277936-38277958 TTTTCGTTCTTTAGGTACAAAGG + Intergenic
1115977748 14:39015423-39015445 CTTTAGTCCTTGATTTTAAAAGG - Intergenic
1115984882 14:39094651-39094673 CTTTAGTTGTCTATTTAAGAAGG - Intronic
1116501434 14:45627924-45627946 CTATAGTTCTTCCTTTAAAAAGG + Intergenic
1116689769 14:48090611-48090633 CTTTTGTTCTTTCGGTTAAAAGG - Intergenic
1116706186 14:48304646-48304668 ATTTGGTTCTTTATGTCAAAAGG + Intergenic
1117108316 14:52421380-52421402 CCTTTGTTCTTTTTATAAAATGG + Intergenic
1117166826 14:53043315-53043337 TTTTACTTCTTTCTGTTAAACGG - Intronic
1117721127 14:58629899-58629921 ATTTAGTTGTTCATGAAAAATGG + Intergenic
1117937648 14:60925311-60925333 CTTAAGTCCCTTATATAAAATGG - Intronic
1118422015 14:65616829-65616851 TTTTTTTTCTTTAAGTAAAAAGG + Intronic
1118686800 14:68299540-68299562 CTCAAGTCCTTTATATAAAATGG - Intronic
1119088951 14:71762199-71762221 CTTTAGGTCTTTAAACAAAATGG + Intergenic
1119375393 14:74187167-74187189 CATTGGTTTTTTCTGTAAAATGG - Intronic
1119957809 14:78819504-78819526 CTTAAGTTCCTTATATAAAATGG - Intronic
1120095740 14:80385826-80385848 CTTTAGTTCTTTCTTTACATAGG + Intronic
1120150398 14:81026461-81026483 CCTTGCTTCTTTATGTAAATAGG - Intronic
1120345677 14:83286748-83286770 CTTTAGTTCTACATGTTAAATGG + Intergenic
1120345864 14:83289335-83289357 CTTAAATTCCTTATATAAAATGG + Intergenic
1120802330 14:88704489-88704511 CTTTTTTTCTGTCTGTAAAATGG - Intronic
1121511833 14:94518351-94518373 CTTCAGTTTTTTCTGTGAAATGG + Intergenic
1121642776 14:95497002-95497024 TTTTATTTCTTTGTTTAAAATGG - Intergenic
1124032260 15:26022354-26022376 ATTTGGGTCTTTATGTCAAAAGG + Intergenic
1125623626 15:41087321-41087343 CTCAAATTCATTATGTAAAATGG - Intronic
1125675297 15:41498972-41498994 CTTGATTTCCTTCTGTAAAATGG + Intronic
1125735324 15:41921091-41921113 CTTGTTTTCTTTATGAAAAATGG - Intronic
1125851679 15:42909733-42909755 TTTTTGGACTTTATGTAAAAGGG - Intronic
1126281077 15:46949880-46949902 CTTTTTTTCTTTATTTAAAAAGG + Intergenic
1126296966 15:47150331-47150353 TTTTATTTTGTTATGTAAAAAGG + Intergenic
1126534564 15:49747395-49747417 CCTTGGTCCTTTATCTAAAATGG - Intergenic
1126791523 15:52226072-52226094 TTTTTTTTCTTTATGTAACAGGG - Intronic
1127029167 15:54842619-54842641 TTCTTGGTCTTTATGTAAAATGG - Intergenic
1127703088 15:61520687-61520709 CTTTAGTTCTGTCTGTAAAATGG + Intergenic
1127745608 15:61968433-61968455 CTCAAGTTCCTTATATAAAATGG - Intronic
1127747237 15:61991131-61991153 TTTTAGTTATATTTGTAAAATGG - Intronic
1127801380 15:62480104-62480126 CTTCAGTTATTTGAGTAAAAGGG + Intronic
1128777347 15:70331318-70331340 TTTTAGATATTAATGTAAAATGG + Intergenic
1128959450 15:71986263-71986285 CTCAAGTCCCTTATGTAAAATGG - Intronic
1129015823 15:72467957-72467979 CTCAAGTTCCTTATATAAAATGG - Intergenic
1130208537 15:81901191-81901213 TTATCGTTCTTTGTGTAAAAAGG + Intergenic
1130335998 15:82957840-82957862 CTTTATTTATTTATTTAAGACGG + Intronic
1130690029 15:86074285-86074307 ATTTAGCTCTTTATATACAAGGG + Intergenic
1130694495 15:86117114-86117136 CCAGATTTCTTTATGTAAAAAGG - Intergenic
1131297664 15:91165526-91165548 CTCAAGTTCTTTATATTAAATGG - Intronic
1132105660 15:99060701-99060723 CTCAAGTTCCTTATATAAAATGG - Intergenic
1132363890 15:101241885-101241907 CTTTAGTCCCTGATATAAAATGG + Intronic
1132990974 16:2793621-2793643 CTGTAGTTCTTTATGTATTCTGG + Intergenic
1133251490 16:4484759-4484781 CTTAAGTTTCTTATATAAAATGG + Intronic
1135109447 16:19679301-19679323 CTTTTTTTCTTTTTGTAAGATGG + Intronic
1135158944 16:20076411-20076433 CTTTATTTCTCCGTGTAAAATGG + Intergenic
1136770373 16:32833644-32833666 AATTAGTTCTTTATGTTAGACGG - Intergenic
1137388502 16:48061666-48061688 CTGTATTTCTTTATGTTATATGG + Intergenic
1138466403 16:57195098-57195120 CTTTAGTTTCTTTTTTAAAAAGG + Intronic
1138662160 16:58527695-58527717 CTTAAGTCCTGTATGTAAAGTGG - Intronic
1138914522 16:61447265-61447287 CTTAAGTCCCTTATATAAAATGG + Intergenic
1139007489 16:62591081-62591103 CTTCATTTCTTTAAGTAAAATGG - Intergenic
1139159055 16:64480988-64481010 CTATAGTGCTTTACATAAAAAGG + Intergenic
1140265177 16:73414538-73414560 CAAAAGTTCTTTATTTAAAAAGG + Intergenic
1140700067 16:77573484-77573506 CTTTAGTTTCTTTGGTAAAAAGG + Intergenic
1203072794 16_KI270728v1_random:1095751-1095773 AATTAGTTCTTTATGTTAGACGG - Intergenic
1143864664 17:9915354-9915376 CTTGGTTTCTTTATGAAAAATGG - Exonic
1143924847 17:10360490-10360512 CTTGCTTTCTTTATGGAAAAGGG - Intronic
1144265496 17:13564449-13564471 CTCAAGTTCCTTATATAAAATGG + Intronic
1144503276 17:15807834-15807856 AATTAGATCTGTATGTAAAATGG - Intergenic
1145074879 17:19844300-19844322 CTTTAATTCTTTGTGGAAATGGG + Intronic
1145165456 17:20610541-20610563 AATTAGATCTGTATGTAAAACGG - Intergenic
1145715800 17:27019709-27019731 TTTAAATTCTTTATCTAAAATGG - Intergenic
1145997787 17:29114520-29114542 ATTTAGTGCCTTCTGTAAAAGGG - Intronic
1146105501 17:30032090-30032112 CTTTAGTAATTTGTTTAAAATGG - Intronic
1146966087 17:37031352-37031374 CTCAAGTTCCTTATATAAAATGG - Intronic
1147678768 17:42225588-42225610 CTCAAGTTCCTTATATAAAATGG + Intronic
1149275852 17:55034826-55034848 TTTTTGTGCTTTATGTAAAATGG + Intronic
1149462740 17:56845222-56845244 TTTTATTTCTTTTTTTAAAATGG - Intronic
1150010375 17:61497267-61497289 GTTCAGTTCTTTGTGTAAACAGG - Intergenic
1150320653 17:64211659-64211681 TTTCAGTCCCTTATGTAAAATGG - Intronic
1150545417 17:66152282-66152304 CTTTCTATCTCTATGTAAAAAGG - Intronic
1153281487 18:3418426-3418448 CTCAAGTTCATTATATAAAATGG + Intronic
1153527344 18:6009569-6009591 CTTGAGTCCCTTATATAAAATGG + Intronic
1155248413 18:23933226-23933248 CTATAGTTCTTTCTTTGAAATGG - Intronic
1155368411 18:25072390-25072412 TTTAAGTTCTTAATGGAAAATGG - Intronic
1155734025 18:29198822-29198844 CTTTAGTTCAGTATATAAAAAGG - Intergenic
1155856143 18:30837306-30837328 CTTTAGTTCATTTTGTAATCAGG + Intergenic
1155943896 18:31826418-31826440 CTTTAGTTCAGCATGTCAAAGGG - Intergenic
1155947703 18:31875060-31875082 CTTAAATTCTTTCTGGAAAAAGG + Intronic
1156437390 18:37147183-37147205 CATTAATTCTTAAAGTAAAAAGG - Intronic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1156885124 18:42126482-42126504 CTCTATTTCTTCATGTAACACGG - Intergenic
1158077749 18:53550895-53550917 CTCAAGTCCTCTATGTAAAATGG - Intergenic
1158137173 18:54221027-54221049 TTTTACTTGTTTATGTAAAATGG - Intronic
1159569633 18:70097537-70097559 CTTTATGACTTTATGTTAAATGG - Intronic
1160102118 18:75932299-75932321 CTATGCTTCTTTTTGTAAAATGG - Intergenic
1161617389 19:5279297-5279319 CTTTAGTTCTACATGTAAAAAGG - Intronic
1162363569 19:10233933-10233955 ATTTATTTATTTATTTAAAATGG - Intergenic
1162599085 19:11653575-11653597 CTCAAGTGCTTTATATAAAATGG + Intergenic
1163022588 19:14491170-14491192 CTATATTTTCTTATGTAAAAGGG + Intronic
1164322939 19:24167023-24167045 GTTAAGGTCCTTATGTAAAAGGG - Intergenic
1165041815 19:33073783-33073805 ATTTTGTACTTTATATAAAATGG - Intergenic
1165195315 19:34097952-34097974 CTCAAGTCCTTTATATAAAATGG + Intergenic
1165210088 19:34228228-34228250 CATTATTTCATTATCTAAAAAGG + Exonic
1168375562 19:55876329-55876351 CTCAAGTTCCTAATGTAAAATGG + Intronic
1202671138 1_KI270709v1_random:53574-53596 CCTTAGTTCTTTATATTAGACGG + Intergenic
925231573 2:2237674-2237696 CTTAAGTGGTTTATGTAAAGGGG - Intronic
926512753 2:13802946-13802968 CTCAAGTTCCTTATATAAAACGG + Intergenic
927071324 2:19532485-19532507 CCTTAGTTCATTCTGTAAAATGG - Intergenic
927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG + Intergenic
927609819 2:24527002-24527024 CTCAACTTCCTTATGTAAAATGG - Intronic
927760305 2:25746968-25746990 CTCAAGTCCTTTATATAAAATGG + Intronic
928982072 2:37146378-37146400 CTCAAGTCCTTTATATAAAATGG - Intronic
929148705 2:38729087-38729109 CTCTAGTTCCTTCTATAAAATGG + Intronic
929682056 2:44001356-44001378 ATTTAATATTTTATGTAAAATGG - Intergenic
929842430 2:45482805-45482827 CTCAAGTCCTTTATATAAAATGG + Intronic
930049459 2:47203680-47203702 CTTGAGTTCTTCATATAAGATGG - Intergenic
930062399 2:47301046-47301068 ATTTGGTGCTTTATGTGAAAAGG + Intergenic
930929243 2:56860955-56860977 GTTTAGTTCTTTCTTTAAAAGGG + Intergenic
932005787 2:67925834-67925856 CTCAAGTTCCTTATGTAAAATGG - Intergenic
932177511 2:69616374-69616396 TTTTCGTTCTTTTTTTAAAATGG - Intronic
932547296 2:72727019-72727041 CTTAAGTCCCTTATATAAAATGG - Intronic
932674137 2:73763717-73763739 CTTTATTTTTTTTTGTAAGATGG - Intronic
933176705 2:79181820-79181842 CTTTAGCTTTTTATGTAAATGGG + Intergenic
933917680 2:87012878-87012900 CTCAAGTCCCTTATGTAAAATGG - Exonic
934005316 2:87757039-87757061 CTCAAGTCCCTTATGTAAAATGG + Exonic
934069523 2:88371096-88371118 CTCAAGTCCTTTATATAAAATGG + Intergenic
934587863 2:95519943-95519965 CTTTAATTCAGTATGTACAAAGG + Intergenic
935464982 2:103385565-103385587 CTTTAGTTGTTTAAGTCAAGAGG + Intergenic
935507094 2:103919149-103919171 ATTTTGTTCTTTATGTAATGGGG - Intergenic
935768275 2:106391126-106391148 CTCAAGTCCCTTATGTAAAATGG + Intergenic
936085621 2:109466619-109466641 CTTTGGTGTTTTATCTAAAAAGG + Intronic
936882169 2:117266790-117266812 CTCAAGTTCTTTATATAAAATGG - Intergenic
937049625 2:118877784-118877806 CTCAAGTCCCTTATGTAAAATGG - Intergenic
938489247 2:131753358-131753380 CTTTCTTTCTTTATTTAAGATGG + Intronic
939586274 2:144009680-144009702 ATTTAGTCCTTGATTTAAAATGG + Intronic
939736144 2:145849169-145849191 TAGTAGTTCTTTATATAAAATGG + Intergenic
939895694 2:147788465-147788487 CTTAAATTCTTTACATAAAATGG + Intergenic
940305321 2:152219649-152219671 CTCAAGTCCCTTATGTAAAATGG + Intergenic
940710764 2:157160865-157160887 CTCAAGTTGTTTATATAAAATGG - Intergenic
940848751 2:158668397-158668419 CTTTGCTTCTTTGTGAAAAATGG - Intronic
940850725 2:158685879-158685901 CTTTGGATCGTTAGGTAAAAGGG - Intergenic
941149321 2:161894109-161894131 CTTGAGTTCCTTACATAAAATGG - Intronic
941505237 2:166336036-166336058 CTCAAGTTCTTTACATAAAATGG - Intronic
941514718 2:166459009-166459031 CTCAAGTCCCTTATGTAAAATGG - Intronic
941562736 2:167069062-167069084 CTCAAGTCCTTTATATAAAACGG + Intronic
941625563 2:167826903-167826925 CTTAAGTTCCTTATATAACATGG - Intergenic
941837717 2:170044572-170044594 ATTTAGTTCTTTATGTACAAGGG + Intronic
942870773 2:180732011-180732033 CTTAAATTCTTCTTGTAAAAAGG - Intergenic
942894831 2:181039817-181039839 CTCAAGTTCCTTATATAAAATGG + Intronic
942928984 2:181466772-181466794 CTTTAGCTTTTTAATTAAAATGG - Intronic
943056889 2:182993113-182993135 CTGAAGTTCCTTATATAAAATGG + Intronic
943149030 2:184086402-184086424 CTCTAGTCCTTTATATAAAATGG - Intergenic
943272952 2:185830495-185830517 CTCAAGGTCTTTATATAAAATGG + Intronic
943407181 2:187504232-187504254 CTCTAGTTCTTCTTTTAAAAAGG + Intronic
943574429 2:189614582-189614604 CTCAAGTTCTTTATATAAAATGG - Intergenic
943772117 2:191729540-191729562 CTTTGTTTCTTTGTGTAAAATGG + Intergenic
944244747 2:197519420-197519442 CTTAAGTTTCTTAAGTAAAATGG + Intronic
944462110 2:199960691-199960713 CTCAAGTCCTTTATATAAAATGG - Intronic
944597131 2:201271228-201271250 CTTTTTTTTTTTCTGTAAAATGG - Intronic
944610142 2:201395107-201395129 CATTATTTCTCTTTGTAAAATGG - Intronic
944994110 2:205274233-205274255 CTTTATTTCTTTGTGTGAATAGG + Intronic
945314466 2:208356791-208356813 CTTGACTTCTTTTTGTAACAAGG + Exonic
947240480 2:227989227-227989249 CAGTAGTTCTTTATTTTAAAAGG - Intronic
947454297 2:230239279-230239301 CTTAAGTCCCTTATATAAAATGG + Intronic
947570530 2:231230663-231230685 CTCAAGTCCTTTATGTAAAATGG + Intronic
947668065 2:231919464-231919486 CTTCAGGTCTGGATGTAAAAGGG + Intergenic
948336447 2:237211102-237211124 CCTTAGGTCTTTATGTCTAATGG + Intergenic
948417752 2:237826883-237826905 CTCAAGTCCCTTATGTAAAATGG - Intronic
1168983574 20:2027614-2027636 CTCAAGTCCTTTATATAAAATGG + Intergenic
1169555935 20:6750101-6750123 TTTTAATTCTGTATGTAAATAGG - Intergenic
1169585093 20:7072833-7072855 CTTGAGTTTCTTATGTGAAATGG + Intergenic
1169665346 20:8028157-8028179 GTGTAGTTCTTTATATCAAAGGG + Intergenic
1169845850 20:9990720-9990742 CTTTAGTTCTTTATGTAAAATGG - Intronic
1170183429 20:13559610-13559632 CTTTGGTTCTAGATGTAAAGAGG + Intronic
1170295517 20:14820387-14820409 CTTTAGTTTTATAATTAAAAAGG + Intronic
1170714783 20:18822215-18822237 CTTTTGTGCTTTATATAAATGGG + Intronic
1171225852 20:23441517-23441539 CTGAAGTCTTTTATGTAAAATGG + Intronic
1172440532 20:34962534-34962556 CTTAAGTCCCTTATATAAAATGG + Intergenic
1173051153 20:39563213-39563235 ATTAAGTTCTTTAAGCAAAATGG + Intergenic
1173274719 20:41569857-41569879 CTCCAGTTCCTTATTTAAAATGG - Intronic
1174199384 20:48796870-48796892 TTTTTGAACTTTATGTAAAATGG - Intronic
1174713945 20:52736879-52736901 CTTAATTTCTTTTAGTAAAATGG + Intergenic
1174976951 20:55346380-55346402 CTCAAGTCCTTTATGTAAAATGG + Intergenic
1174979539 20:55378010-55378032 ATTTTGTTTTTTAAGTAAAAAGG - Intergenic
1175035476 20:55996197-55996219 CTTAAGTCCCTTATATAAAATGG + Intergenic
1175208626 20:57331524-57331546 ATTTAGTCATTAATGTAAAAGGG + Intronic
1176981769 21:15390157-15390179 CTCAAGTCCTTTATATAAAATGG - Intergenic
1176997435 21:15572163-15572185 CTCAAGTTCCTTATATAAAATGG + Intergenic
1177235868 21:18389292-18389314 CTTTATCTTTTTATGCAAAAAGG - Intronic
1177633368 21:23754925-23754947 ATTTAGTTCTTGCTGTAAAATGG + Intergenic
1177753225 21:25312470-25312492 CTTTAGTTGTTTTTAAAAAAAGG + Intergenic
1177867309 21:26527386-26527408 CTTTATTTGGTTATGTAAATTGG - Intronic
1177879810 21:26678851-26678873 CTTGAGTTCTTAAAGAAAAAAGG - Intergenic
1177962748 21:27688878-27688900 TTTTAGTTCTTTAAATAAACAGG + Intergenic
1178008574 21:28254750-28254772 CTCAAGTCCTTTATATAAAATGG - Intergenic
1178068901 21:28939248-28939270 CTCAAGTTCCTTATATAAAATGG - Intronic
1179268751 21:39831437-39831459 ATTTTTTTCTTTATGTATAATGG - Intergenic
1179339680 21:40493310-40493332 CTTTAGTGTTTCTTGTAAAAGGG - Intronic
1179811635 21:43874915-43874937 CTTAAGTTCCTGATATAAAATGG + Intronic
1180499589 22:15920360-15920382 GTGTATTCCTTTATGTAAAATGG + Intergenic
1181866589 22:25862177-25862199 CATGAGTCCTTTATATAAAATGG - Intronic
1184072937 22:42157269-42157291 CTCAGGTTCCTTATGTAAAATGG + Intergenic
1184972361 22:48034777-48034799 CTTAAATTCTTTAGGTAAAGCGG - Intergenic
949122111 3:398821-398843 CTTTCCTTCTTTATTTAAAAAGG - Intronic
949287353 3:2422337-2422359 CTTTAGAGCTTTTTATAAAATGG + Intronic
949484560 3:4525632-4525654 CTTTAGTTCTTTTATTAATATGG + Intronic
949617686 3:5772520-5772542 CTCAAGTTCCTTATGTAAAATGG - Intergenic
949701181 3:6761110-6761132 CTTTACTTCTCTGTTTAAAATGG + Intergenic
950779995 3:15383198-15383220 CCTTAGGTCTTTATGTAGATAGG - Exonic
950961240 3:17110307-17110329 CTCAAGTTCTGTATATAAAATGG - Intergenic
951314625 3:21174039-21174061 CTTGAGTTCTTTATATATACTGG + Intergenic
951920317 3:27847579-27847601 CTCAAGTCCTTTATATAAAATGG - Intergenic
952649015 3:35700372-35700394 CCTAATTTCTTTATATAAAATGG - Intronic
952759207 3:36898889-36898911 TTTTAGTCATTTATGTGAAAAGG + Intronic
952977202 3:38706695-38706717 CTTGAGATCTTTATGAAAAAAGG + Intronic
953182586 3:40610039-40610061 CCATAGCTCTTTCTGTAAAATGG - Intergenic
953542224 3:43831405-43831427 CCTTAGTTCTATATGTAAATGGG + Intergenic
953981527 3:47415636-47415658 CCTTGTTTCTTTATGGAAAAAGG - Intronic
954735475 3:52704058-52704080 CTCAAGTCCCTTATGTAAAATGG + Intronic
955369041 3:58334818-58334840 CTTTTTCTGTTTATGTAAAATGG + Intronic
955543964 3:60007665-60007687 CTTTAGGTCTTTATTTCTAAAGG - Intronic
955627952 3:60939411-60939433 CTTTAGTCCTTTACAGAAAAAGG + Intronic
955655361 3:61239718-61239740 TTTTATTTCTCTTTGTAAAATGG - Intronic
955747328 3:62153160-62153182 CTTTGGTACTTTATAGAAAACGG + Intronic
956340497 3:68218036-68218058 CTTCAGATCTTTATGACAAATGG + Intronic
956539242 3:70315922-70315944 ATTTAGTTCATTATTTTAAATGG - Intergenic
956604525 3:71059811-71059833 CTTTAGTTCTTAAAGGGAAAAGG + Intronic
956757067 3:72399107-72399129 CTCAAGTCCCTTATGTAAAATGG + Intronic
957038102 3:75313499-75313521 TTTTTTTTCTTTTTGTAAAAAGG - Intergenic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
957284029 3:78193404-78193426 CTCAAGTTCTTTGTATAAAATGG - Intergenic
957562426 3:81839830-81839852 TTTTAGTACCTTATGTAAGATGG + Intergenic
957583197 3:82103189-82103211 CTGAAGTGCTTTATGTTAAATGG - Intergenic
957594601 3:82246344-82246366 CTTAAGTCTCTTATGTAAAATGG + Intergenic
958685572 3:97388390-97388412 TTTTACTTCTATATGTACAAAGG + Intronic
958874392 3:99599224-99599246 CATTAGCTCTTTATTTGAAATGG - Intergenic
959229986 3:103635933-103635955 CATTAATTCATTATTTAAAAAGG + Intergenic
959385412 3:105699410-105699432 TTTTATTCCTTTATATAAAATGG - Intronic
960033343 3:113077662-113077684 CTCTAGTTCCTTTTATAAAATGG + Intergenic
960228316 3:115193391-115193413 CTTAAGTTCTTGATATAAACTGG - Intergenic
960285674 3:115825911-115825933 GTTTATTTCTTTTTGTAAACAGG + Intronic
960438983 3:117663550-117663572 CTCAAGTCCTTTATATAAAATGG + Intergenic
960632833 3:119750475-119750497 CCTTAGTTCTTAATGTGGAAGGG - Intronic
960718956 3:120606376-120606398 CTAAAGTCCCTTATGTAAAATGG + Intergenic
960905584 3:122597831-122597853 CTCAAGTCCCTTATGTAAAATGG + Intronic
960908865 3:122628895-122628917 TTTAAGTTCTTTTTGGAAAAGGG - Intronic
960963446 3:123088679-123088701 CTCAAGTCCTTTATATAAAATGG + Intronic
961696874 3:128711474-128711496 CTTTTGTATTTTTTGTAAAAAGG + Intergenic
961700301 3:128738744-128738766 ATTTAGTTCTTTCTTTCAAATGG - Intronic
963054382 3:141173495-141173517 ATTTAGTTCTTTTTCTGAAAAGG + Intergenic
963068729 3:141284588-141284610 CTCAAGTCCCTTATGTAAAATGG + Intronic
963193359 3:142498830-142498852 CTTTATTTCATTAGATAAAATGG + Intronic
963507892 3:146210033-146210055 CTTAAGTCCCTTATATAAAATGG + Intronic
963512562 3:146267062-146267084 CTCAAGTCCTTTATGTACAATGG - Intergenic
963655349 3:148041963-148041985 CTTAAGTACTTCATATAAAATGG - Intergenic
963809673 3:149763473-149763495 TTTTTATTCTTTATTTAAAAAGG - Intronic
963817477 3:149848007-149848029 CTTTATTTCTTCATGTAAACTGG + Intronic
963826642 3:149962503-149962525 CTTTAATTTTTTATAAAAAAGGG - Intronic
964063151 3:152549934-152549956 TTTTAGTTCTTTATATAAAATGG + Intergenic
964137081 3:153356134-153356156 CTTTTTTTCTTTCTTTAAAATGG - Intergenic
964221424 3:154350820-154350842 CTTAAGTCCCTTATATAAAATGG + Intronic
964346532 3:155759611-155759633 ATTTAGTTCTTTATTTCTAAAGG - Intergenic
964359838 3:155883650-155883672 CTTTGGTTCTTCATGCAAACAGG + Intronic
964770079 3:160215455-160215477 CTCAAGTCCTTTATATAAAATGG + Intergenic
965315598 3:167186283-167186305 ATTTAGTTGTCTATGTACAAAGG - Intergenic
965718446 3:171632971-171632993 CTTTATTTCTTTGTGAAAAATGG + Intronic
965761852 3:172086383-172086405 CATTTGTTCTTTATATTAAAAGG - Intronic
965889408 3:173492114-173492136 CCTCAGTTCTTTACATAAAATGG + Intronic
966002145 3:174962868-174962890 CTATATTTCCTTATATAAAATGG + Intronic
966373519 3:179272810-179272832 ATTTTGTACTTCATGTAAAATGG - Intergenic
966451297 3:180065701-180065723 CTATAGTTTTTTATGTCAGAAGG - Intergenic
966585343 3:181617513-181617535 CTTTAATTTTTAAAGTAAAATGG - Intergenic
966980047 3:185124175-185124197 CTCAAGTTCCTTATATAAAAGGG - Intronic
967175820 3:186863173-186863195 CTTTAGTTATTTAGAAAAAAAGG + Intergenic
967335579 3:188340478-188340500 TTTGAGTCCTTTATGTAAACGGG + Intronic
967476794 3:189930819-189930841 CTCAAGTTCCTTATATAAAATGG + Intergenic
967521683 3:190439645-190439667 CTTTACTTCCTTATGCAAACTGG + Intronic
967704550 3:192634470-192634492 CGCAAGTCCTTTATGTAAAATGG - Intronic
968159471 3:196413807-196413829 CTCAAGTTCTTCATATAAAATGG + Intronic
968527207 4:1066667-1066689 TTTTAGTTCTTTATGTATTCTGG + Intronic
970001211 4:11367837-11367859 TTTTAGTGGTTTATGAAAAAAGG - Intergenic
971534170 4:27727480-27727502 ATTTTACTCTTTATGTAAAAGGG - Intergenic
972062160 4:34889259-34889281 CTTTATTTCTTTATTTTAAAAGG + Intergenic
972414081 4:38821566-38821588 CTCAAGTCCCTTATGTAAAATGG - Intronic
972522620 4:39874379-39874401 CTTTGCTTTTTGATGTAAAATGG + Exonic
972795484 4:42413523-42413545 CTTAAATCCTTTATATAAAATGG + Intronic
973179819 4:47253269-47253291 TGTTAGTTGTTTATGTCAAAGGG + Intronic
973603459 4:52563969-52563991 CTTTATCTCTTTATTAAAAATGG - Intergenic
973628831 4:52799475-52799497 CTCAAGTTCCTTATATAAAATGG - Intergenic
973687178 4:53383168-53383190 CTTTAGATCTTTTTGCAAGAGGG + Intronic
975148762 4:70998533-70998555 CTCAAGTCCTTTATGTAAAATGG - Intronic
975285278 4:72610121-72610143 CTTCAGTTAATAATGTAAAAAGG + Intergenic
975929109 4:79496446-79496468 CTTAAGTACCTTATATAAAATGG - Intergenic
976413123 4:84740055-84740077 ATTTAAACCTTTATGTAAAAAGG - Intronic
976505451 4:85840613-85840635 CTTTGGTTCTGTATTTTAAAGGG + Intronic
976784483 4:88802519-88802541 CTTCAGTCCTTTCTGTAATATGG - Intronic
977180438 4:93867025-93867047 GTGTAGTTCTATTTGTAAAATGG - Intergenic
977215456 4:94278035-94278057 CTTTATTTCTTTGTGGAAAATGG - Intronic
977298376 4:95236981-95237003 CTCAAGTCCCTTATGTAAAATGG + Intronic
977809559 4:101345216-101345238 ATTTTGTTCTTTCTGAAAAAAGG + Intronic
978067046 4:104417983-104418005 CTTTATTGCTATATGGAAAATGG - Intergenic
978142011 4:105328776-105328798 CTTTTGTTCTTTTTGGCAAATGG + Intergenic
978568214 4:110107451-110107473 CTTTAGTTATTAATGTATTACGG - Intronic
978583131 4:110252158-110252180 CTTAAGTTCTTTGTGTAAAATGG + Intergenic
978844988 4:113262789-113262811 CTCAAGTCCTTTATATAAAATGG - Intronic
979169147 4:117577622-117577644 ATCTAGCTCTTTATTTAAAAGGG + Intergenic
979244112 4:118479286-118479308 CTCAAGTTCCTTATGTAAAATGG + Intergenic
979651321 4:123135745-123135767 CTCAAGTCCTTTATATAAAATGG - Intronic
979935235 4:126685553-126685575 CTTTAATTCATCATTTAAAATGG - Intergenic
980696993 4:136370705-136370727 CTCAAGCTCTTTATATAAAATGG - Intergenic
980824323 4:138055193-138055215 CTTTTGTTCTTGATGTTTAAAGG + Intergenic
981198461 4:141948245-141948267 CTTTAGTTCTTTTATGAAAATGG - Intergenic
981205015 4:142030515-142030537 CTTTAGCTCTTTGTGCAAGAAGG + Intronic
981860689 4:149352566-149352588 CTTAAGTCCTTTATATAAAATGG - Intergenic
982080392 4:151783949-151783971 ATTTGGCTCTTTATGTCAAAAGG + Intergenic
982199682 4:152948256-152948278 CTTTTGTTTTTTATGTCAAAGGG - Intronic
982588474 4:157273204-157273226 CTCTAGTGCATTATATAAAATGG - Intronic
983153793 4:164319303-164319325 CTTATGTTCCTTATATAAAATGG - Intronic
983615439 4:169699235-169699257 CTTAATTTCTTGATGGAAAAAGG - Intronic
983783802 4:171706668-171706690 CTATAGTTCTGTAAGAAAAATGG - Intergenic
983836803 4:172397581-172397603 ATTTATTTATTTATTTAAAATGG + Intronic
985031985 4:185798429-185798451 CTTTTTTTCTTTGTTTAAAACGG - Intronic
986038756 5:3965741-3965763 CCTTCTTTCTTTATTTAAAAGGG - Intergenic
986057284 5:4150934-4150956 CTCAAGTCCTTTATATAAAATGG - Intergenic
986398796 5:7358852-7358874 CTCAAGTTCCTTATATAAAATGG - Intergenic
986532811 5:8757131-8757153 CATTAGTTCTCTAAGTATAATGG + Intergenic
986605955 5:9523085-9523107 TTTTCCTTATTTATGTAAAATGG + Intronic
986656948 5:10022521-10022543 CTTTAGTGTTTCTTGTAAAATGG - Intergenic
986923241 5:12714070-12714092 TTTTATTTCTTTATTTAACATGG + Intergenic
987786781 5:22510592-22510614 CTCAAGTCTTTTATGTAAAAAGG + Intronic
987861260 5:23491241-23491263 GTTTGGTTCTTTCTGAAAAATGG + Intergenic
987995805 5:25277064-25277086 CTTTTATTCTATATGTAAATAGG - Intergenic
988028503 5:25731147-25731169 CTCTATTTCCTTATATAAAATGG - Intergenic
988151351 5:27385906-27385928 CTCAAGTCCTTTATATAAAATGG + Intergenic
989222571 5:38985217-38985239 CTCAAGTCCTTTATATAAAATGG + Intronic
989520532 5:42395980-42396002 CTCAAGTCCCTTATGTAAAATGG - Intergenic
989523156 5:42424033-42424055 CTCTAGTTGTTTATGAAAACGGG + Intronic
989702295 5:44284153-44284175 CTTTTGACCTTTATGTACAAAGG - Intergenic
989766893 5:45097732-45097754 TTTTAGTTCTTTATTTCACATGG - Intergenic
990846690 5:60148471-60148493 CTTAAGTTCCTTACATAAAATGG - Intronic
990932685 5:61111439-61111461 ATTTATTTATTTATTTAAAATGG + Intronic
990964180 5:61427262-61427284 CTTAAGTCCCTTATATAAAATGG + Intronic
991913101 5:71581022-71581044 CTCAAGTCCTTTATATAAAATGG + Intergenic
992042103 5:72845855-72845877 CTTTAGTTTCTTGTTTAAAAGGG + Intronic
992629143 5:78664127-78664149 CTCAAGTCCTTTATATAAAATGG - Intronic
992734285 5:79703381-79703403 TTTTTGTTCTTATTGTAAAATGG - Intronic
992912841 5:81415345-81415367 CTTAAGTCCTTTATATAAAACGG + Exonic
992949714 5:81846710-81846732 CTTTGTTTCTTTGTGAAAAATGG + Intergenic
993142128 5:84047703-84047725 CTTTCTTTTTTTATGTAAAATGG - Intronic
993355270 5:86898788-86898810 CTCAAGTCCTTTATATAAAATGG - Intergenic
993678306 5:90844877-90844899 CTTTTGTTGTTTGTGTAAACTGG + Intronic
994527811 5:100928418-100928440 CTCAAGTCCCTTATGTAAAATGG + Intergenic
994651820 5:102538725-102538747 CTTTAGATTTCTATATAAAAAGG - Intergenic
995150163 5:108834202-108834224 CTTTAATTTTTTCTGTAAATTGG + Intronic
995235042 5:109818960-109818982 CTCAAGTCCTTTATATAAAATGG + Intronic
995371454 5:111423703-111423725 CTTCAGTTCTTTGTATAAAATGG + Intronic
995429842 5:112061682-112061704 CTTTAGTTCTTTAGTTTAAGGGG - Intergenic
995710498 5:115030502-115030524 ATTTAGTAATTTTTGTAAAAGGG - Intergenic
995818356 5:116197817-116197839 CTGTACTTCTTTATGTGAACTGG - Intronic
996195999 5:120607886-120607908 ATTTATTTCTTTATTTACAAGGG - Intronic
996475166 5:123909922-123909944 CTTTAGTTCCTAATGTTACATGG - Intergenic
996712218 5:126554524-126554546 ATCTGGTTCTTTATGGAAAAAGG - Intronic
997014538 5:129917295-129917317 CTAAAGTTCCTTATATAAAATGG + Intronic
997093867 5:130888591-130888613 CTGAAGTTGTTTATATAAAATGG + Intergenic
997162225 5:131621220-131621242 CTTGAGTCCCTTATATAAAATGG + Intronic
997182992 5:131851860-131851882 CTAAAGTTCCTGATGTAAAATGG - Intronic
997549811 5:134742118-134742140 CTCAAGTCCCTTATGTAAAACGG - Intronic
1000286981 5:159835221-159835243 CTTTATTTCTTTTTCTAATATGG - Intergenic
1000594295 5:163196151-163196173 CATTTTTTTTTTATGTAAAATGG - Intergenic
1000778656 5:165451527-165451549 TTCTAGTATTTTATGTAAAATGG + Intergenic
1000853657 5:166371919-166371941 CTTTAATTCTTTTTTAAAAAAGG - Intergenic
1001006321 5:168053701-168053723 CTCAAGCTCTTTATATAAAATGG - Intronic
1001050807 5:168412870-168412892 CTCAAGTGCTTTATATAAAATGG - Intronic
1001619699 5:173073264-173073286 TTTTATTTATTGATGTAAAAAGG + Intronic
1001794468 5:174490577-174490599 CTTTTTTTTTTCATGTAAAAAGG - Intergenic
1001896649 5:175388320-175388342 TTTTATTTATGTATGTAAAAAGG + Intergenic
1003048431 6:2757841-2757863 ATTTCCTTCTTAATGTAAAAAGG + Intergenic
1003198365 6:3935237-3935259 CTTAAGTTCCTTATATAAAATGG - Intergenic
1003379663 6:5611936-5611958 CTTTTGTTCCTTATGGAAAATGG - Intronic
1004038229 6:11945989-11946011 TTTTAATTCATTTTGTAAAATGG + Intergenic
1004711325 6:18173387-18173409 TTGTAGTTCTTTATGTAATCTGG + Intronic
1004811003 6:19263092-19263114 CATGACTTCTTTAGGTAAAAGGG + Intergenic
1005261495 6:24065838-24065860 GTTTCTTTCTTTGTGTAAAAAGG + Intergenic
1005655044 6:27927494-27927516 CTTTAGTTATTTATTTAAATTGG + Intergenic
1005655066 6:27927705-27927727 CTGTATTTCTTTTTGTATAAAGG + Intergenic
1005891576 6:30144550-30144572 CTTCATTTTTTTCTGTAAAAAGG - Intronic
1006331258 6:33392560-33392582 ATTTAGTTCTTTCTCTTAAATGG + Intronic
1006440362 6:34050003-34050025 ATTTAGTTTTTTATGCAGAATGG - Intronic
1006560157 6:34904116-34904138 CTCAAGTCCTTTATATAAAATGG + Intronic
1006567250 6:34970503-34970525 CTCAAGTCCCTTATGTAAAACGG + Intronic
1007252753 6:40507270-40507292 GTTTAGTTCATGATCTAAAAGGG + Intronic
1007877859 6:45126843-45126865 ATTTAGTTCATTTTTTAAAAAGG + Intronic
1008288559 6:49684212-49684234 CTCAAGTCCTTTATATAAAATGG + Intergenic
1008384307 6:50870897-50870919 CTTGAATTCTTTAGGGAAAAGGG - Intergenic
1008747724 6:54692956-54692978 CTTAAGTTCCTTATATAAAATGG + Intergenic
1008776287 6:55042292-55042314 CTTTATGTCTTGATATAAAAAGG - Intergenic
1008793837 6:55275523-55275545 ATTTAGATCATTATCTAAAAAGG + Intronic
1009211268 6:60865958-60865980 CTTAAGTCCCTTATGTAAAATGG + Intergenic
1009285760 6:61814902-61814924 CTCAAGTTCCTTATATAAAATGG + Intronic
1009298158 6:61980898-61980920 ATTCAGCTCTTTATGTCAAAAGG - Intronic
1009311675 6:62161528-62161550 CTCAAGTTCCTTATTTAAAATGG - Intronic
1009419443 6:63449056-63449078 CTCAAGTTCCTTATATAAAATGG - Intergenic
1009503324 6:64444207-64444229 CTTCAGTTAATAATGTAAAAAGG + Intronic
1009516093 6:64620075-64620097 CTCTAGTTATTTAAGCAAAACGG + Intronic
1009533880 6:64855829-64855851 CTTTATGTCATTATGAAAAAGGG - Intronic
1009922827 6:70084066-70084088 GTTTAAATCTTTGTGTAAAAGGG - Intronic
1009956519 6:70461454-70461476 TTTCAGTTCTTTACATAAAATGG - Intronic
1010047534 6:71463907-71463929 CCTCAGTTTTTTATGTAAACTGG + Intergenic
1010214618 6:73390398-73390420 CTCAAATTCTTTACGTAAAATGG + Intronic
1010225878 6:73488491-73488513 TTGTAGTTCTTTATGTATACTGG + Intronic
1010722517 6:79300007-79300029 TTATTGTTCTTTTTGTAAAAAGG - Intergenic
1010722595 6:79300807-79300829 CTTGAGTTTTTAAAGTAAAAAGG - Intergenic
1011357075 6:86482275-86482297 CCTTAGTTATTTATTTAACAGGG - Intergenic
1011508145 6:88070707-88070729 CTTTAGTACTTCATGAAAAATGG + Intergenic
1011579665 6:88846345-88846367 ACTTAGTTCTTTATGTAATAAGG - Intronic
1011845447 6:91558391-91558413 CTTTTGATTTTTATGCAAAATGG + Intergenic
1011980597 6:93371432-93371454 CTTAAGTCCCTTATATAAAATGG - Intronic
1012291144 6:97457441-97457463 CTTAAGTCTTTTATATAAAATGG - Intergenic
1012329779 6:97970357-97970379 CTCAAGTCCTTTATCTAAAATGG - Intergenic
1012567039 6:100670370-100670392 CTTAAGTCCCTTATATAAAATGG + Intronic
1012819891 6:104072914-104072936 CTCAAGTCCTTTATATAAAATGG + Intergenic
1013252901 6:108352412-108352434 CTCAAGTCCCTTATGTAAAATGG + Intronic
1013540945 6:111108401-111108423 CTTCAGTTAATAATGTAAAAAGG + Intronic
1014030055 6:116690789-116690811 CTCAGGTCCTTTATGTAAAATGG + Intronic
1014258536 6:119188728-119188750 CTTGAGTCCCTTATATAAAATGG + Intronic
1014376823 6:120686282-120686304 CTTTATTACTTTCTGTAGAAAGG - Intergenic
1014508996 6:122297251-122297273 TTCTAGTTTTTTATTTAAAATGG + Intergenic
1014773281 6:125480884-125480906 CTTGATTTCTTTCTGTAAAATGG - Intergenic
1015416493 6:132954920-132954942 CTTTAAATATGTATGTAAAAAGG - Intergenic
1015454364 6:133408926-133408948 CTTTTTTTCACTATGTAAAAAGG - Intronic
1015457943 6:133450506-133450528 CTTTATTTATTTATTTAAGATGG + Intronic
1015644449 6:135370606-135370628 CTTTACTTCTTTATGCAGTAGGG + Intronic
1015939579 6:138434166-138434188 CATTAATTCTTTATGTCAGAAGG + Intronic
1017366993 6:153654880-153654902 CTCTAGTCCCTGATGTAAAATGG - Intergenic
1017821925 6:158055157-158055179 CTTTGGTCCTTTATGCAAGAAGG + Intronic
1018541595 6:164886098-164886120 CATTATTTCTTTCTGTAAAATGG - Intergenic
1018754124 6:166834033-166834055 CCTTAGATATTTATGCAAAAGGG - Intronic
1019403520 7:869710-869732 GTGTAGTACTGTATGTAAAATGG - Intronic
1020800315 7:12724487-12724509 CTTGAGTCCCTTATATAAAATGG + Intergenic
1020807854 7:12812518-12812540 ATTTAATACATTATGTAAAATGG - Intergenic
1021172541 7:17415232-17415254 ATATAATTCTTTTTGTAAAATGG + Intergenic
1021778078 7:24073428-24073450 CTTTAGTTTTTAAAATAAAATGG - Intergenic
1022012784 7:26323466-26323488 TTTTTGCTCTTTATATAAAAAGG + Intronic
1022041427 7:26585584-26585606 TTTTATTGCTTTAAGTAAAAGGG + Intergenic
1024949743 7:54847741-54847763 CTCAAGTTCTTTATATGAAATGG - Intergenic
1025552009 7:62262103-62262125 AATTAGTTCTTTATGTTAGACGG - Intergenic
1027586886 7:80068945-80068967 CTCAAGTACTTTATATAAAAAGG - Intergenic
1027595725 7:80171544-80171566 ATTTACATCTTGATGTAAAATGG + Intronic
1028282437 7:88947837-88947859 CTTAAGTTGCTTATGTGAAATGG - Intronic
1028360573 7:89962158-89962180 CTCAAGTTCCTGATGTAAAATGG - Intergenic
1028507077 7:91582579-91582601 CTCAAGTTCCTTATATAAAATGG - Intergenic
1028574126 7:92327432-92327454 CTCAAGTCCCTTATGTAAAATGG + Intronic
1028660273 7:93264029-93264051 CTCAAGTTCTTTATATAAAATGG - Intronic
1028672439 7:93418744-93418766 CTAAAGTTCCTTATATAAAATGG - Intergenic
1029952209 7:104598837-104598859 CTTCAGTTAATAATGTAAAAAGG + Intronic
1029992347 7:104973885-104973907 TTCTAGATCTTTTTGTAAAAAGG + Intergenic
1030020097 7:105265402-105265424 CTCAAGTCCTTCATGTAAAATGG - Intronic
1030295465 7:107921600-107921622 CTTTAGTTGTTTAGCTGAAAAGG + Intronic
1030413081 7:109206223-109206245 CTCAAGTTCTTCATATAAAATGG - Intergenic
1030576667 7:111295694-111295716 TTTTACTTGTGTATGTAAAATGG - Intronic
1030845541 7:114404456-114404478 CTTTAGATCTTCATATATAAGGG - Intronic
1031484860 7:122313654-122313676 CCTTTGTTTTTTCTGTAAAATGG + Intergenic
1031708278 7:125010386-125010408 CTCAAGTCCGTTATGTAAAATGG + Intergenic
1031760561 7:125708204-125708226 CTATTGTTCTTTATGGAACAGGG - Intergenic
1031793188 7:126135838-126135860 CTCTAATTTTTTATTTAAAAAGG - Intergenic
1031932641 7:127701751-127701773 CTCGAGTCCTTTATATAAAATGG + Intronic
1032091149 7:128912281-128912303 CTCTGATTCTTTCTGTAAAATGG - Intergenic
1032354803 7:131200725-131200747 CTTTAGTTTTTCAGGAAAAATGG - Intronic
1033525186 7:142206231-142206253 ATTTAGTTCTTTTTCAAAAATGG + Intronic
1033947072 7:146732734-146732756 CTTCAGTTCTTTATTTTAAATGG + Intronic
1034143600 7:148848217-148848239 TTTTAGTGTTTTAAGTAAAAGGG + Intronic
1035145248 7:156809422-156809444 CTCAAGTCCCTTATGTAAAATGG + Intronic
1035440925 7:158899077-158899099 CTCAAGTTCCTTAAGTAAAATGG + Intronic
1036037674 8:5037827-5037849 CTCAAGTTCCTTATATAAAATGG + Intergenic
1036279499 8:7387972-7387994 CTGAAGTCCTTGATGTAAAATGG - Intergenic
1036342020 8:7923905-7923927 CTGAAGTCCTTGATGTAAAATGG + Intergenic
1036960397 8:13239061-13239083 CTTTCTTGCTTTATATAAAAAGG + Intronic
1036991115 8:13595555-13595577 CTTGAGTTCTTTATGATTAAGGG + Intergenic
1037052051 8:14385877-14385899 GTTCAATCCTTTATGTAAAATGG + Intronic
1038251137 8:25906052-25906074 CTTTAGTTATTTACTTAAATGGG - Intronic
1038463638 8:27739655-27739677 CTTGAGTCCCTTGTGTAAAATGG - Intronic
1038494803 8:27993743-27993765 CATTTGTTCTTTCTGTAAAATGG - Intergenic
1039365033 8:36920243-36920265 CTCAAGTCCTTTATATAAAATGG + Intronic
1040727696 8:50402621-50402643 AATTAATTCTCTATGTAAAATGG - Intronic
1040860641 8:51995370-51995392 CTTCAGTTTTATCTGTAAAATGG + Intergenic
1040974883 8:53178923-53178945 TTTTATTTCTATTTGTAAAATGG + Intergenic
1041451517 8:58011456-58011478 ATTTGGCTCTTTATGTCAAAAGG - Intronic
1041595555 8:59646630-59646652 CTCAAGTTCCTTATATAAAATGG + Intergenic
1042132155 8:65598186-65598208 CTTTAGTTTCCTACGTAAAATGG + Intergenic
1042298933 8:67254434-67254456 CTTAAGTTCTTTATGGAAGGTGG - Intronic
1042401499 8:68353895-68353917 CTCAAGTTCCTTATATAAAATGG - Intronic
1042404139 8:68384084-68384106 TTTTAGTTCATTTTGTTAAAAGG - Intronic
1043083087 8:75791390-75791412 CTTCAGTTTTCTATGTAAAATGG + Intergenic
1043156576 8:76788767-76788789 TTTTAGTTCTTTGTATACAAAGG + Intronic
1043229483 8:77783707-77783729 CTTTAATTTTTTAAGGAAAATGG + Intergenic
1043997132 8:86831920-86831942 CTTTAGGACTTTATGTTAACAGG + Intergenic
1044099101 8:88108507-88108529 TTTTTCTTCTTTATGTAATATGG + Intronic
1044287624 8:90427570-90427592 CTTTGGTTCTTTACATCAAAAGG + Intergenic
1044788392 8:95820900-95820922 CTCAAGTCCCTTATGTAAAATGG + Intergenic
1045921117 8:107530490-107530512 CTTAAGTTCTTTTTGAAACAGGG + Intergenic
1046172089 8:110522777-110522799 CTTTAGTTGTGTATGTAAAGTGG + Intergenic
1046581279 8:116095450-116095472 CCTTAGATCTCTATGTGAAAAGG + Intergenic
1046640957 8:116730911-116730933 CTTTGTTTCCTTATGTAAAATGG - Intronic
1046642571 8:116748766-116748788 CTCAAGTCCTTTATATAAAATGG + Intronic
1047165229 8:122431332-122431354 CTTAAGTCCCTTATATAAAATGG - Intergenic
1047182975 8:122606648-122606670 CTTTCATTCTTGATGTAGAAAGG + Intergenic
1047889236 8:129289298-129289320 CTCAAGTTCCTTATATAAAATGG + Intergenic
1048286886 8:133148707-133148729 CTTAAATTCTTTATATAAAATGG - Intergenic
1048290701 8:133179324-133179346 CTTTACTTCTATAGGTAAAAAGG + Intergenic
1048360089 8:133690142-133690164 CTTAATTTCTTTTTGGAAAATGG + Intergenic
1048994147 8:139780624-139780646 CTTTGGTGTTGTATGTAAAATGG - Intronic
1049960714 9:735604-735626 CTCAAGTCCCTTATGTAAAATGG + Intronic
1050862424 9:10450732-10450754 CCTTTGTTCTTTCTGTGAAAAGG + Intronic
1050912241 9:11086102-11086124 CATGAGTTCTTTAGGTAAATAGG - Intergenic
1050947168 9:11539547-11539569 GTTCAGTTCCTTATATAAAATGG + Intergenic
1051201037 9:14624246-14624268 CTCCTGTTCCTTATGTAAAATGG - Intronic
1051258770 9:15241143-15241165 CCTTAGCTCTGTATGGAAAATGG + Intronic
1051527969 9:18068462-18068484 TTTAAGTTCCTTATATAAAATGG - Intergenic
1052134736 9:24896160-24896182 CTTAAGTCCCTTATATAAAATGG - Intergenic
1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG + Intronic
1053382948 9:37663745-37663767 CTCAAGTCCTTTATATAAAATGG + Intronic
1055799187 9:80014116-80014138 TTTAAGTCCCTTATGTAAAATGG + Intergenic
1055906323 9:81297678-81297700 CTGTATTTCTATATATAAAATGG - Intergenic
1055915745 9:81398338-81398360 CCTGAGCTCATTATGTAAAAAGG - Intergenic
1055941814 9:81657722-81657744 CTCAAGTCCTTTATATAAAATGG + Intronic
1056410072 9:86317045-86317067 CTCAAGTTCCTTATATAAAATGG - Intronic
1056653655 9:88490978-88491000 CTTAAGTTCCTTATATAACATGG + Intergenic
1057116688 9:92530104-92530126 CTCAAGTTCCTTATATAAAATGG - Intronic
1058069601 9:100588240-100588262 CTTTAGTTTTCAATATAAAAAGG - Intergenic
1058171431 9:101685891-101685913 CTATATTCATTTATGTAAAATGG - Intronic
1058298106 9:103334496-103334518 CTTCATTTCTTTATGTAGACAGG + Intergenic
1058477927 9:105359203-105359225 CTGTACTACTTTATGGAAAAAGG - Intronic
1059005931 9:110402765-110402787 CTTCAGCTCTATATCTAAAAGGG + Intronic
1059288348 9:113197773-113197795 CTTCAGTTATTGAAGTAAAATGG - Intronic
1059631436 9:116127758-116127780 CTCAAGTTCCTTATATAAAATGG - Intergenic
1059701180 9:116776556-116776578 CTGTGATTCTATATGTAAAATGG + Intronic
1060033322 9:120234102-120234124 CTCTAGTGCTTTATGGTAAAGGG - Intergenic
1060131905 9:121109088-121109110 CTCAAGTCCTTTATGTAAAATGG + Intronic
1060234077 9:121849899-121849921 CTCGAGTTCCTTATATAAAATGG + Intronic
1060546034 9:124459810-124459832 CTCAAGTTTTTTATATAAAATGG - Intronic
1060628788 9:125137603-125137625 CTTTATTTATTTATTTAAGACGG + Intronic
1062121883 9:134838325-134838347 CCTTAGTTCTGTGTGTAGAAGGG - Intronic
1186738623 X:12493949-12493971 TTTTAGTTTTATGTGTAAAATGG - Intronic
1186868503 X:13745837-13745859 CATTTGTTCTTTATGTGTAAAGG + Intronic
1187640106 X:21277996-21278018 GTTTGGTTCTTTCTGAAAAATGG - Intergenic
1187644879 X:21336242-21336264 CATTAGTTCTCTAAGTATAATGG - Intergenic
1187666899 X:21623274-21623296 CATTATTACTTTAGGTAAAAGGG - Intronic
1188147472 X:26630936-26630958 CTCAAGTTCCTTATATAAAATGG - Intergenic
1191829781 X:65404137-65404159 CTTTATTTGTTTATGAAAACCGG + Intronic
1191937267 X:66439088-66439110 CTTTAGGTCTTCTTGTAAAGGGG + Intergenic
1191960918 X:66701421-66701443 CTTTTTTTTTTTTTGTAAAAGGG - Intergenic
1192763400 X:74119283-74119305 CATTACTTCTTTGTGTAAAAGGG - Intergenic
1193242187 X:79184090-79184112 CTTAAGTGCCTTATATAAAATGG - Intergenic
1193377225 X:80775935-80775957 CTTAATTTCTTTATTTACAAAGG - Intronic
1193838788 X:86382207-86382229 CTTTATTTCTTTTTGAATAAGGG + Intronic
1194332761 X:92603744-92603766 CTTTAGTATTTTATGTAACATGG - Intronic
1194540019 X:95158097-95158119 TTTTGGTTCTTTTTGTATAATGG - Intergenic
1194706028 X:97176873-97176895 CTCAAGTTCTTTATTTAAAATGG + Intronic
1194730491 X:97447646-97447668 CGTTAGCTCTGTATGTAACAGGG + Intronic
1195857833 X:109349722-109349744 CTGTAGTTGTTTATGTAGCAGGG + Intergenic
1196100195 X:111839626-111839648 CTCAAGTTCCTTATATAAAATGG + Intronic
1196475313 X:116077866-116077888 CTTAAGTCCTTTATAAAAAACGG - Intergenic
1197012664 X:121586137-121586159 CTCAAGTTCTTTAGCTAAAATGG - Intergenic
1197124612 X:122929742-122929764 TTCTAGTTGTTTATTTAAAACGG + Intergenic
1197182678 X:123553101-123553123 TTTAAGTACTTTAAGTAAAAAGG - Intergenic
1197752054 X:129971508-129971530 TTTTAGTTCTTTAAGGAAAGAGG + Intergenic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1198502260 X:137262418-137262440 CTGAAGTTCATTATATAAAATGG + Intergenic
1198690863 X:139282768-139282790 CTCCAGTTCTTTACCTAAAATGG + Intergenic
1199116853 X:144002551-144002573 AGTTGGTTCTTTATGTCAAAAGG + Intergenic
1200543123 Y:4484683-4484705 CTCAAGATCTTTATCTAAAATGG + Intergenic
1200641456 Y:5722788-5722810 CTTTAGTATTTTATGTAACATGG - Intronic
1201268980 Y:12236146-12236168 ATTTGGTTCTTTATGTGAAGAGG - Intergenic