ID: 1169846367

View in Genome Browser
Species Human (GRCh38)
Location 20:9996572-9996594
Sequence CTGTCTTGGTAGAGAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169846363_1169846367 11 Left 1169846363 20:9996538-9996560 CCAGAAGTGCACACAGATGAGGC No data
Right 1169846367 20:9996572-9996594 CTGTCTTGGTAGAGAGAACAGGG No data
1169846361_1169846367 12 Left 1169846361 20:9996537-9996559 CCCAGAAGTGCACACAGATGAGG No data
Right 1169846367 20:9996572-9996594 CTGTCTTGGTAGAGAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169846367 Original CRISPR CTGTCTTGGTAGAGAGAACA GGG Intronic
No off target data available for this crispr