ID: 1169846367

View in Genome Browser
Species Human (GRCh38)
Location 20:9996572-9996594
Sequence CTGTCTTGGTAGAGAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169846363_1169846367 11 Left 1169846363 20:9996538-9996560 CCAGAAGTGCACACAGATGAGGC 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1169846367 20:9996572-9996594 CTGTCTTGGTAGAGAGAACAGGG 0: 1
1: 0
2: 1
3: 20
4: 211
1169846361_1169846367 12 Left 1169846361 20:9996537-9996559 CCCAGAAGTGCACACAGATGAGG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1169846367 20:9996572-9996594 CTGTCTTGGTAGAGAGAACAGGG 0: 1
1: 0
2: 1
3: 20
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169846367 Original CRISPR CTGTCTTGGTAGAGAGAACA GGG Intronic
900028075 1:348027-348049 TTGTCCTGATAAAGAGAACAAGG - Intergenic
900535918 1:3177353-3177375 TTGTCATTGTAGGGAGAACACGG + Intronic
900753793 1:4418942-4418964 CTGTCCTGGTAGAGAACCCAAGG - Intergenic
900903436 1:5533202-5533224 CTTTCTTGGTTAAGAGAAAATGG - Intergenic
901280387 1:8029239-8029261 CTGTCTTTGGAGTGAGAACAAGG + Intergenic
903233538 1:21936059-21936081 CTCTCTTGGCTCAGAGAACAGGG + Intronic
907877087 1:58501574-58501596 CTGTCTTGGGGAAGAGTACAAGG - Intronic
908415073 1:63905109-63905131 TTGTCTTAGTGCAGAGAACATGG + Intronic
908426120 1:64009185-64009207 CTGCCTTTGGAGAGAGACCACGG - Intronic
910724297 1:90322498-90322520 ATGGATTGGTAGAGAGAAGATGG + Intergenic
914984152 1:152441961-152441983 CTGGCTTGGAAGGGAGACCAAGG + Intergenic
916713022 1:167428706-167428728 CTGGCTTGGCAGAGAAAAAATGG - Intergenic
916934584 1:169614381-169614403 CTATCTTGGTGAAGAGGACATGG - Intronic
917827129 1:178835299-178835321 ATTTCTAGGTAAAGAGAACAAGG - Intronic
923706788 1:236350609-236350631 TTGGCTTGGTAGACAGAAAAAGG + Intronic
924956840 1:248936964-248936986 TTGTCCTGATAAAGAGAACAAGG + Intergenic
1063877513 10:10495542-10495564 CTGTTCAGGTAGAGAGGACAGGG - Intergenic
1064393968 10:14965451-14965473 CTGTCGTGGTACTGAGACCATGG - Intronic
1064694661 10:17953333-17953355 CTGTCTCAGTAGAAAAAACACGG - Exonic
1067105543 10:43363702-43363724 CTGCCCTGGTAGCGAGCACAGGG + Intergenic
1067412750 10:46079214-46079236 CTGTCTTTATAGAGAGCACAAGG - Intergenic
1069168740 10:65198190-65198212 CAGTCTGGGTAGATAGAGCAGGG + Intergenic
1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG + Intronic
1072244854 10:93534303-93534325 CTGGCATGGTAGAAAGAAGATGG - Intergenic
1072578693 10:96721765-96721787 CTGGCTTTGAAGATAGAACAAGG - Intergenic
1073649487 10:105343407-105343429 CTGTCTAGGTAGGGGGAAAAAGG - Intergenic
1076962734 10:133778624-133778646 TTGTCCTGATAAAGAGAACAAGG + Intergenic
1079105963 11:17572558-17572580 CTGACTGTGTAGAAAGAACAAGG - Intronic
1079477799 11:20849480-20849502 CTCTCCTGGTAGAGAGGTCATGG - Intronic
1081323039 11:41714480-41714502 CTGTCTTCTTAGAAACAACACGG - Intergenic
1084218298 11:67663400-67663422 CTGTGTGGGCACAGAGAACAAGG + Intronic
1085833319 11:79926429-79926451 CTTTCTTGCTAGAGGGTACATGG + Intergenic
1086449932 11:86906071-86906093 TTGCCTTTGTAGAGAGAACAAGG + Intronic
1087425085 11:97975383-97975405 CTGTATAGGTAGGGTGAACAAGG + Intergenic
1088423269 11:109671951-109671973 CTCTCTAGGAAGAGAGAAAATGG - Intergenic
1088747525 11:112816970-112816992 CTCTCTTCCTAGAGAGAACTGGG - Intergenic
1091536564 12:1415677-1415699 CTTTCTTGGTATGGAGAAAATGG + Intronic
1092662909 12:10758181-10758203 CTGTCTTTGTGGAGAGAAATGGG + Intergenic
1096750518 12:53756047-53756069 CTGGCTTGGTGGAGGGAACCAGG + Intergenic
1098924599 12:76335311-76335333 ATGGCATGGTACAGAGAACATGG - Intergenic
1099840020 12:87953866-87953888 ATGTCTTGGTAGTGATGACAAGG - Intergenic
1100590755 12:96026132-96026154 CTATTTTGGGAGAGAGAACCAGG - Intronic
1100678992 12:96898413-96898435 ATGGCTTGGCAGAGAGAAGATGG + Intergenic
1101738510 12:107481809-107481831 CTGTCTTGGAAGCGAGATGATGG + Intronic
1102333973 12:112061518-112061540 CTATTTTGGTAGATAGAAAATGG - Intronic
1105834654 13:24198697-24198719 CAGACTTGGCAGAAAGAACAAGG - Intronic
1106642677 13:31600838-31600860 CTGTCTTGTTCTAAAGAACAAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1108666553 13:52638199-52638221 ATTTCTTGGTAGGGATAACAGGG - Intergenic
1110006594 13:70279201-70279223 CTGTCATGGTATAGAATACATGG + Intergenic
1110289776 13:73790896-73790918 CTTTCATGGAAGAGAGAGCATGG - Intronic
1111706402 13:91754463-91754485 CAGTCTTGGTGGATAGCACAAGG - Intronic
1111796777 13:92931038-92931060 CTGTAGTTGTAGAGAGACCAGGG + Intergenic
1112625933 13:101103722-101103744 ATGTCTTTGCAGAGACAACAAGG - Intronic
1113945642 13:114042669-114042691 CTTCCTTGGAAGAGAGAACCGGG - Intronic
1118745120 14:68767872-68767894 TTGTCTGTGTAGAGAGAGCAGGG + Intergenic
1119143503 14:72289276-72289298 CTAACTTTGTAGGGAGAACATGG - Intronic
1121323371 14:93005842-93005864 CTGGCTTGGTAAAAAGGACAGGG + Intronic
1124698148 15:31884766-31884788 CTATCTTGCTAGATAGATCAAGG + Intergenic
1125327922 15:38555497-38555519 CTGTCTTAGGAGAGAGATCCAGG + Intronic
1127542541 15:59955411-59955433 CAGTATTGTTAGTGAGAACAAGG + Intergenic
1129975093 15:79815392-79815414 CAGTGATGGGAGAGAGAACAAGG + Intergenic
1130938795 15:88491056-88491078 CTGGCTGGGCAGCGAGAACACGG + Intergenic
1131123401 15:89837567-89837589 CTGGCTGGGTAGAGAAAACCTGG - Intronic
1131366321 15:91845095-91845117 CTGTCATGCTGGAGAGATCAGGG + Intergenic
1131539954 15:93267663-93267685 CTCACATGGTAGAGGGAACAAGG + Intergenic
1131611021 15:93963847-93963869 CTGTCTTGATTGAAAGAACTGGG - Intergenic
1133919941 16:10143184-10143206 CTGTCTGGGTTGTGAAAACAAGG + Intronic
1137949923 16:52774032-52774054 CTGATTTGGTAGAGAGAGGAGGG - Intergenic
1138726464 16:59145784-59145806 CTGTCTTGTTTGAGAGAAAGTGG - Intergenic
1139084176 16:63563922-63563944 CTGACTTGGTGGAAAGGACATGG + Intergenic
1141104121 16:81219136-81219158 CTGCCTTGGAAGTGTGAACAGGG + Intergenic
1143965838 17:10756042-10756064 CAGTCTGGGTAGGGAGAACAAGG - Intergenic
1145049393 17:19648081-19648103 CTCTCTTGGGAGCGGGAACACGG + Intergenic
1145056734 17:19708007-19708029 CTGCCTTGGTAGAGCCACCATGG - Intronic
1148237179 17:45976621-45976643 CTGCCTTGCTGGAGAGCACAGGG + Intronic
1150553598 17:66233389-66233411 GTCTCTGGGTAAAGAGAACAAGG + Intronic
1151259743 17:72907156-72907178 CTGTCCTGCTGGAGAGCACAAGG + Intronic
1151925022 17:77189206-77189228 CTGGCTTTGTAGACAGAAAAGGG + Intronic
1152186048 17:78856890-78856912 CTGTATGGGGAGAGAGAATATGG - Intronic
1153993157 18:10417755-10417777 GAGTCTTGGTTGAGAAAACAGGG + Intergenic
1154309784 18:13258190-13258212 CTGTCTTGGTTGGGAAAAAATGG - Intronic
1156026801 18:32664026-32664048 CTCTCTTGGAAGAGAGAATGGGG + Intergenic
1156575875 18:38314350-38314372 TAGCCTGGGTAGAGAGAACATGG + Intergenic
1156575969 18:38315408-38315430 TGGTCTGGGTAGAGAGAACACGG + Intergenic
1157383512 18:47243126-47243148 CTGTCTTGGTAGAGAGGAATGGG + Intronic
1157875528 18:51269924-51269946 CTTTTTGGGTAGAGAAAACATGG + Intergenic
1157942545 18:51945050-51945072 CTTTTTTGGTATAAAGAACAAGG - Intergenic
1162286429 19:9742417-9742439 CTTTCCTGGTAGAGACAAAAAGG + Intergenic
1165496162 19:36152811-36152833 CTGGCTGTGTAGACAGAACAGGG - Exonic
1167735148 19:51289855-51289877 CTGCTTTGGAAGAGAGCACATGG - Intergenic
927968960 2:27292003-27292025 CTGTCTTGGGAGAGAGAAATCGG - Intronic
928467843 2:31539594-31539616 CAGTGTTAGTAGAGACAACATGG + Intronic
928698068 2:33870780-33870802 CTGCCCTGGTAGAGTGACCATGG + Intergenic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
929909774 2:46079799-46079821 CTGTCTTTGAAGAGAAAACTAGG - Intronic
931941331 2:67254917-67254939 CTGTCATGATTGTGAGAACAGGG + Intergenic
933755194 2:85632923-85632945 CATTCTAGGTAGAGAGGACATGG + Intronic
934573719 2:95387452-95387474 CTGTCTTGATGAATAGAACATGG + Intergenic
934621459 2:95811565-95811587 CTCTCTAAGCAGAGAGAACAGGG + Intergenic
934811984 2:97287250-97287272 CTCTCTAAGCAGAGAGAACAGGG - Intergenic
934825709 2:97420677-97420699 CTCTCTAAGCAGAGAGAACAGGG + Intergenic
936924023 2:117718588-117718610 CTGGCTTGGAGGAGAGATCAGGG - Intergenic
940138458 2:150465488-150465510 CTGTCTTTGAAGACAGAAAAAGG - Intergenic
942307293 2:174621149-174621171 CTGTGTTGGTACAGACAACCAGG + Intronic
942323713 2:174757561-174757583 CTCACTTGTTATAGAGAACAAGG + Exonic
943327136 2:186514352-186514374 CCTTCTTGGAAGAGAGAACAGGG - Intergenic
946125325 2:217557649-217557671 CTGTCTTGGTAGAAATAAACTGG + Intronic
947137563 2:226990299-226990321 CATTCTTGAAAGAGAGAACATGG + Intronic
947269724 2:228320558-228320580 CTGTCTAGGTAGACTGTACATGG + Intergenic
947326328 2:228982240-228982262 CTGTCGTGGTATGGAGAGCAAGG + Intronic
947648440 2:231763203-231763225 CTGTCTTGCTAGAGAGCCAAAGG + Intronic
947764971 2:232632205-232632227 TTGACTTGGTACAGAGAATACGG - Intronic
947993997 2:234511834-234511856 CTGTCTGGGGGGAGAGGACATGG - Intergenic
948173055 2:235921659-235921681 CTGTCTTGATAAACATAACATGG + Intronic
949088177 2:242175550-242175572 TTGTCCTGATAAAGAGAACAAGG + Intergenic
1169846367 20:9996572-9996594 CTGTCTTGGTAGAGAGAACAGGG + Intronic
1170104070 20:12734833-12734855 CTGTCTTGCTACAGGGAAAAAGG - Intergenic
1172168791 20:32916213-32916235 CTCACATGGTAGAGAGGACAAGG + Intronic
1172331070 20:34076610-34076632 CTTTCCTGGTTGAAAGAACAGGG + Intronic
1172704321 20:36872006-36872028 TGGTCTTGGTGGAGAGGACATGG - Intergenic
1173033813 20:39389352-39389374 CTGTCTAGAGAGAGAGAAGAAGG - Intergenic
1173388420 20:42609612-42609634 ATATCTTGGTAGAAAGAACGAGG - Intronic
1175308004 20:57991257-57991279 CTGTCTTGTTAGGGAGAGGACGG + Intergenic
1178164448 21:29957339-29957361 CTGTCTTGGGATGGAGAGCATGG + Intergenic
1178799871 21:35783418-35783440 GTTTCTTGGTAGCAAGAACAAGG + Intronic
1178865956 21:36327530-36327552 CTGGCTTTGTAGACAGAAAAAGG + Intronic
1178991137 21:37357716-37357738 CTCTGTTGGGACAGAGAACATGG - Intergenic
1179601295 21:42479215-42479237 CTTACTAGGGAGAGAGAACACGG + Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1181792664 22:25280192-25280214 CTCTTTTGGCAGAAAGAACAAGG - Intergenic
1181813198 22:25417777-25417799 CTGTTTTGGCAGAAAGACCAAGG - Intergenic
1181899437 22:26140653-26140675 CTGTCTTGGTAGCAAAAACATGG - Intergenic
1185082200 22:48715658-48715680 CTGTCCTGCTGGAGAGAAGAGGG + Intronic
949135578 3:561029-561051 CTTTCATGGTAAAGAGCACATGG + Intergenic
951499321 3:23366533-23366555 CTGACCTGTAAGAGAGAACATGG - Intronic
953909031 3:46882648-46882670 ATGTTTTCGTAGAGAGAAAAGGG + Intronic
956274607 3:67484470-67484492 CTGTAATGGTACATAGAACATGG - Intronic
956501343 3:69888853-69888875 CTGTCTTGGTGAAGAGAAAAGGG + Intronic
959306057 3:104667285-104667307 CTGTCTGGGGAGATAGATCATGG - Intergenic
959796580 3:110437143-110437165 CTGTCTTGGTAAAAAGAATTGGG - Intergenic
959860543 3:111210440-111210462 CTGTCTAGGTACTGAGAATATGG + Intronic
964158649 3:153618508-153618530 CTGTCTTGGGAGAGCAAAGAAGG - Intergenic
968805589 4:2769846-2769868 ATGTCTAGATAGGGAGAACAAGG + Intergenic
968819329 4:2837773-2837795 CAGTCTAGGTGGAGGGAACAGGG - Exonic
970044234 4:11831816-11831838 ATGTGTTGTTAGAGAGACCACGG + Intergenic
970123928 4:12788296-12788318 ATGTCATGCTAGAGAGAATATGG + Intergenic
971038066 4:22716978-22717000 ATGTCCTGGTAGGAAGAACAGGG + Intergenic
971843893 4:31893652-31893674 CTATGTTGTTGGAGAGAACACGG - Intergenic
972789195 4:42354506-42354528 GTGTCCTGGTAGAAAGAACAGGG + Intergenic
977008661 4:91607207-91607229 TTATATTGGTAAAGAGAACATGG + Intergenic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977515001 4:98011107-98011129 CTGTCTGGGGATAGAGCACAGGG - Intronic
978104498 4:104884810-104884832 CTGTCTTGGTAGGGATAAACTGG + Intergenic
979546116 4:121941926-121941948 CTGTCTAGTTAGAGAGTACATGG + Intronic
980062534 4:128147315-128147337 CTGTCTTAGCAGTGAGAAAAAGG - Intronic
980104604 4:128575807-128575829 GTGTCTAGGGAGAGAGAAAATGG - Intergenic
982579228 4:157157065-157157087 CTGTGTTGGTAGAGACAACATGG - Intronic
983194235 4:164787599-164787621 CTGTCATGGAAGAGAGAAGACGG - Intergenic
984720979 4:182972903-182972925 CTGACTTTGTAGTGAGAACTTGG + Intergenic
985259188 4:188099145-188099167 CCGTGTGGGGAGAGAGAACATGG - Exonic
985465965 4:190196104-190196126 TTGTCCTGATAAAGAGAACAAGG + Intergenic
992516219 5:77495450-77495472 CTGACTTTGCAGAGAGAAAAGGG + Intronic
996025341 5:118639046-118639068 CTGTTCTGGTGGAGAGAGCAGGG - Intergenic
996303274 5:122015251-122015273 CTGTCTTGGTAGAAACAATTTGG - Intronic
997376770 5:133403130-133403152 CTGTCTTGGGAGAGAAACAAAGG - Intronic
997655319 5:135550105-135550127 CTGACTTGGTGGACAGAATATGG + Intergenic
998929168 5:147161496-147161518 CTGTGTTGGCAAAGAGCACATGG + Intergenic
1001426516 5:171626036-171626058 CTGTCTTGGGGGAGAGAATTGGG + Intergenic
1002745915 5:181472344-181472366 TTGTCCTGATAAAGAGAACAAGG + Intergenic
1004259817 6:14098042-14098064 TTGTCTTTGTAGAGACAATATGG + Intergenic
1004482671 6:16035879-16035901 CACTTTTGATAGAGAGAACATGG + Intergenic
1005146806 6:22700989-22701011 CTGTCTTGGAAGACAGAGGAAGG - Intergenic
1006029336 6:31167945-31167967 CCGTCTTGGTGGGGAGAAAAAGG - Intronic
1006150433 6:31984050-31984072 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006156734 6:32016788-32016810 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006337719 6:33429113-33429135 CAGACTTAGAAGAGAGAACAGGG + Intronic
1006583808 6:35092386-35092408 TTTTATTGGTAGAGAAAACAAGG + Intergenic
1008928471 6:56912076-56912098 CTGTCTTGGGAGAAAGAGCCTGG - Intronic
1009459505 6:63894967-63894989 CTGTCTTAGTACAGCCAACATGG - Intronic
1010853526 6:80808416-80808438 CTGTCTTAGCAGACAGAGCAAGG - Intergenic
1011558979 6:88596225-88596247 CTGTCTTGGAAAGGAGAAGAAGG + Intergenic
1011989604 6:93497533-93497555 CTGCTTTGGAAGAGAGATCAAGG - Intergenic
1012638863 6:101582951-101582973 CTGTACTGTTTGAGAGAACAGGG - Intronic
1013414223 6:109910248-109910270 CTGTCCTGTTAGAGAGTAGATGG + Intergenic
1013579779 6:111522216-111522238 TTGTCTTGGTTTGGAGAACAAGG - Intergenic
1014911769 6:127103349-127103371 CTGTCTTGATATAGAGTACCGGG - Intergenic
1015693433 6:135953362-135953384 TGGTGTTGGTAGAAAGAACAGGG + Intronic
1017684817 6:156901553-156901575 CTGCCTTGGTGGAGAAAACAGGG - Intronic
1017903469 6:158738327-158738349 CTTTCTTGGTAGAGTAAAAAGGG - Intronic
1018678546 6:166243774-166243796 CTGTCTTCGTGGAGAGCACGTGG - Intergenic
1019032039 6:169022186-169022208 GTCACTTGGTAGAGAGGACAGGG + Intergenic
1019250832 6:170745899-170745921 TTGTCCTGATAAAGAGAACAAGG + Intergenic
1021268929 7:18560722-18560744 CTGTTTTGATAGAGGGAACGTGG + Intronic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1028859841 7:95636775-95636797 CTGTCTAGGCAGAGAGACAAAGG - Intergenic
1029600013 7:101558023-101558045 CTGGCAGGGTCGAGAGAACATGG - Exonic
1037755027 8:21705036-21705058 CTGTCGTGGCAGCGGGAACATGG - Exonic
1038034421 8:23675238-23675260 GTGACTGGGTAGAGAGAAAAGGG - Intergenic
1038478433 8:27885155-27885177 CTGTCTTGGACAAGTGAACAAGG + Intronic
1038747130 8:30264306-30264328 CATTCTTGGTAGACACAACAGGG + Intergenic
1039947734 8:42144446-42144468 CAGCCTTGGTAGAGACAAGAGGG - Intergenic
1041692113 8:60698691-60698713 GTTTCTTAGTAAAGAGAACATGG + Intronic
1041880731 8:62746968-62746990 CGGTCATGGTGGAGAGAACATGG + Exonic
1042287262 8:67127368-67127390 CTCACATGGTAGAGAGAGCAAGG + Intronic
1042466627 8:69135794-69135816 CTGTTTTGGCAGAGAGATCTGGG + Intergenic
1044522077 8:93210387-93210409 CTCACTTGGTAGACAGAAAATGG - Intergenic
1047063743 8:121257022-121257044 CTGTCAAAGTACAGAGAACATGG - Intergenic
1047490817 8:125373359-125373381 TGGTGTTGGCAGAGAGAACAAGG - Intergenic
1048025066 8:130578503-130578525 CTGGCTTGGCAGAGGGACCAGGG + Intergenic
1050857121 9:10373354-10373376 CTGTCCAAGTATAGAGAACAAGG - Intronic
1053268881 9:36736378-36736400 CTGTCGTGGAAGAGAGAAGCTGG - Intergenic
1053551401 9:39082892-39082914 CTGTCCTGGTACAGAGACAAAGG - Intronic
1053815515 9:41903010-41903032 CTGTCCTGGTACAGAGACAAAGG - Intronic
1054615081 9:67284430-67284452 CTGTCCTGGTACAGAGACAAAGG + Intergenic
1055252072 9:74319679-74319701 GGGTCTTGGGAGAGAGAAGATGG + Intergenic
1055464463 9:76550422-76550444 CTGTCTTGGTAGAAAGAAATTGG + Intergenic
1056995825 9:91458149-91458171 CTGTCCTTGTAGAGAGAATTTGG + Intergenic
1057527459 9:95815632-95815654 GTGTCATAGTAGAAAGAACATGG - Intergenic
1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG + Intronic
1057923071 9:99115239-99115261 CAGTCTTGGTGGTGAGAACAAGG - Intronic
1059730982 9:117056662-117056684 GTGCCTTGGTAAAGATAACAAGG - Intronic
1062675985 9:137744101-137744123 CTGTCTTGGGTGACAGCACAAGG + Intronic
1203580384 Un_KI270745v1:38496-38518 TTGTCCTGATAAAGAGAACAAGG + Intergenic
1186671886 X:11775736-11775758 CTGTCTTGTTTGAAAGAACCAGG + Exonic
1189458464 X:41216324-41216346 GTGTTTTGGTGGAGAGTACATGG + Exonic
1190713214 X:53083881-53083903 GTGTCTAGGTATAGAGAAAAAGG + Intronic
1194947015 X:100081143-100081165 CTGGCTGTGTAGAGATAACATGG - Intergenic
1195197653 X:102515857-102515879 CTCTCTTTGCAGAGAAAACATGG - Intronic
1197412525 X:126137168-126137190 CTGTCTTGCTAGAAAGGTCAAGG - Intergenic
1199249552 X:145644548-145644570 CTGTCTTGAAAGAAAGAGCAAGG + Intergenic
1199318908 X:146415099-146415121 CTGTCTTTGAAGATAGAAGAAGG + Intergenic
1201332496 Y:12840289-12840311 GTGTTTTGGTGGAGAGTACATGG + Exonic