ID: 1169849599

View in Genome Browser
Species Human (GRCh38)
Location 20:10035057-10035079
Sequence GCGCGCGGGCAGGTGAGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 256}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169849599_1169849606 -4 Left 1169849599 20:10035057-10035079 CCTGCGCTCACCTGCCCGCGCGC 0: 1
1: 0
2: 2
3: 32
4: 256
Right 1169849606 20:10035076-10035098 GCGCTCGCCTTCCGGGGACCCGG 0: 1
1: 0
2: 1
3: 8
4: 74
1169849599_1169849608 -2 Left 1169849599 20:10035057-10035079 CCTGCGCTCACCTGCCCGCGCGC 0: 1
1: 0
2: 2
3: 32
4: 256
Right 1169849608 20:10035078-10035100 GCTCGCCTTCCGGGGACCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 63
1169849599_1169849610 5 Left 1169849599 20:10035057-10035079 CCTGCGCTCACCTGCCCGCGCGC 0: 1
1: 0
2: 2
3: 32
4: 256
Right 1169849610 20:10035085-10035107 TTCCGGGGACCCGGGGCCCATGG 0: 1
1: 0
2: 0
3: 37
4: 167
1169849599_1169849603 -10 Left 1169849599 20:10035057-10035079 CCTGCGCTCACCTGCCCGCGCGC 0: 1
1: 0
2: 2
3: 32
4: 256
Right 1169849603 20:10035070-10035092 GCCCGCGCGCTCGCCTTCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 79
1169849599_1169849607 -3 Left 1169849599 20:10035057-10035079 CCTGCGCTCACCTGCCCGCGCGC 0: 1
1: 0
2: 2
3: 32
4: 256
Right 1169849607 20:10035077-10035099 CGCTCGCCTTCCGGGGACCCGGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169849599 Original CRISPR GCGCGCGGGCAGGTGAGCGC AGG (reversed) Exonic