ID: 1169851184

View in Genome Browser
Species Human (GRCh38)
Location 20:10053231-10053253
Sequence CCTCCTATACTGAAGACTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169851180_1169851184 16 Left 1169851180 20:10053192-10053214 CCGAAACCAGCAGAAAATCAAAA 0: 1
1: 3
2: 137
3: 7490
4: 4383
Right 1169851184 20:10053231-10053253 CCTCCTATACTGAAGACTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 144
1169851181_1169851184 10 Left 1169851181 20:10053198-10053220 CCAGCAGAAAATCAAAAACTAAA 0: 1
1: 0
2: 6
3: 121
4: 1474
Right 1169851184 20:10053231-10053253 CCTCCTATACTGAAGACTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169851184 Original CRISPR CCTCCTATACTGAAGACTGA AGG Exonic
903509673 1:23865842-23865864 CCTCCTTTGCTGGGGACTGAGGG - Intronic
903640444 1:24856344-24856366 CCTTCCATAGTGAAGACTGGAGG + Intergenic
905385510 1:37600865-37600887 CACCCTAGACTGAAAACTGAGGG - Intergenic
905590942 1:39162936-39162958 CCTCCTATGGTGACTACTGAAGG - Intronic
909545016 1:76836793-76836815 CCTACTCTACTGAATACTGTAGG + Intergenic
911195564 1:94991420-94991442 GCTACTATACTGAATACTGTAGG + Intronic
916078596 1:161218056-161218078 CCTCCTCTACTGTCGACTGAAGG + Exonic
1065268253 10:23999694-23999716 CCTTCTATACTGAATATTGCGGG - Intronic
1069917828 10:71798194-71798216 CCTCCTGTGCTGCAGCCTGAGGG + Intronic
1074728700 10:116344374-116344396 GTTACTATACTGAAGACTGTAGG + Intronic
1074960491 10:118440677-118440699 CCTCCAATTCTGATGCCTGATGG - Intergenic
1079497709 11:21064474-21064496 CCTCCGAAATTGAAAACTGAGGG + Intronic
1080282507 11:30574316-30574338 CCTACTGTACTGAATACTGTAGG - Intronic
1082772865 11:57222056-57222078 CCTCCTTCACTGAAGACTTTAGG + Intergenic
1083380692 11:62265966-62265988 CCTCCTTGGCTGAACACTGAGGG - Intergenic
1087620670 11:100538094-100538116 CCTCCTTTACTTCAGATTGAGGG + Intergenic
1087993583 11:104776501-104776523 CCTCCTATACTGGACAGAGAAGG - Intergenic
1088463559 11:110109163-110109185 CCTACAACACTGAAGATTGAAGG - Intronic
1088632123 11:111783648-111783670 CTTCCTATACTAAAAAGTGATGG + Intronic
1089638949 11:119834290-119834312 CATTCTAGACTGAAAACTGAAGG + Intergenic
1089908411 11:122070103-122070125 CCTCCTATGCTGCAGACTGCAGG + Intergenic
1090156213 11:124441170-124441192 CCTCCTATTCTCAAGAAGGAAGG - Intergenic
1090207237 11:124892213-124892235 CCTTCCACACTCAAGACTGATGG + Intronic
1090603220 11:128394134-128394156 CCAAATATACAGAAGACTGATGG + Intergenic
1091887513 12:4027357-4027379 ACTCCTCTACTGAACTCTGAGGG - Intergenic
1094288018 12:28816328-28816350 CCTTCTATACTCAAGACGGAAGG - Intergenic
1096616598 12:52836572-52836594 ACTGCTATACTGATTACTGAGGG + Intergenic
1099846424 12:88033615-88033637 ACTCCTGTAATGAAGAATGATGG + Intronic
1099904870 12:88760271-88760293 CCTCCTCTCCTGAAGACCTATGG - Intergenic
1101508051 12:105365670-105365692 GCTCCTCTACTTAAGTCTGATGG + Intronic
1102960178 12:117087474-117087496 CCTCCAATTCTCAGGACTGAAGG + Intronic
1107193352 13:37617365-37617387 CCTCCTATACTCATGAGTAAAGG + Intergenic
1112687868 13:101852377-101852399 CCTTCTATACTGAAGAATATGGG + Intronic
1114211640 14:20620822-20620844 CATTCTGTGCTGAAGACTGAAGG + Intergenic
1118896004 14:69946165-69946187 TCTACTATGCTGGAGACTGAAGG + Intronic
1119226680 14:72949912-72949934 CCTCCTACACTGAGGACTTGTGG - Intronic
1119270629 14:73301285-73301307 CCTCAGATACTGAACACTGCAGG - Intronic
1126028889 15:44476649-44476671 ACTACTATACTGAATACTGTAGG - Intronic
1126729837 15:51671547-51671569 CATCCTCTACTGAAGGCTGCAGG + Intergenic
1127300627 15:57650234-57650256 GCCCCTCTGCTGAAGACTGAAGG + Intronic
1130653323 15:85774701-85774723 CATCCTGTAGTGAAGAATGATGG - Intronic
1131644113 15:94323559-94323581 CCTCCTATTGTCAAGGCTGAAGG - Intronic
1132315913 15:100890219-100890241 CCTCAGATACTAAAGAATGACGG - Intronic
1133993882 16:10732104-10732126 CCTGCTCAACTGAAGACTTAGGG - Intergenic
1137085408 16:36114815-36114837 ACTACTATACTGAATACTGCAGG + Intergenic
1137538545 16:49346032-49346054 CCACCTACAGGGAAGACTGAGGG - Intergenic
1138392464 16:56680332-56680354 GCTACTGTACTGAATACTGAAGG - Intronic
1140893116 16:79301964-79301986 CGTCCTATGCCGAAGCCTGATGG + Intergenic
1144631642 17:16876024-16876046 CCAGCTATTCTGAAGACTGAGGG - Intergenic
1145751959 17:27361569-27361591 GCTCCTAGGCTGAAGAGTGAAGG - Intergenic
1146813107 17:35919501-35919523 GTTACTATACTGAATACTGAAGG + Intronic
1148252092 17:46091680-46091702 GCTACTATACTGAATACTGTAGG - Intronic
1150457772 17:65321407-65321429 CCTCCTCTACTGCTGACTGCAGG + Intergenic
1203182467 17_KI270729v1_random:75015-75037 ACTACTATACTGAATACTGCAGG - Intergenic
1157743716 18:50116248-50116270 CCGCCTATACTGCAGAGAGAAGG - Intronic
1158330148 18:56353164-56353186 CCTCCTATTCCCAACACTGAGGG - Intergenic
1158872985 18:61706859-61706881 TCTCCTACTCTGAAGACTGAAGG - Intergenic
1161962806 19:7532037-7532059 CCTACTAAACTGAGGACAGAGGG - Intronic
1163681898 19:18687581-18687603 CCTCCCATACTGTAGACAGCAGG + Intronic
1166422186 19:42646061-42646083 CCTCCTATACAGAAGAGAAACGG - Intronic
925372758 2:3359271-3359293 GCTACTATACTGAAAAATGAAGG + Intronic
926027116 2:9555370-9555392 CCTTCTACACTGAAAACTTAGGG + Intronic
929183214 2:39066083-39066105 CCTTCTACCCTGAAGGCTGAGGG - Intronic
930207795 2:48605720-48605742 GCTACTATACTGAATACTGTAGG + Intronic
930758058 2:54998907-54998929 CCTTCTATACTGCAGAATAAAGG + Intronic
931936085 2:67198107-67198129 GTTCCTATACTGAATACTGTAGG - Intergenic
933034050 2:77369791-77369813 CTTACTATACTGAATACTGTAGG + Intronic
933843989 2:86310363-86310385 GCTACTATACTGAATACTGTAGG - Intronic
935465183 2:103388520-103388542 GCTTCTATACTGAAAATTGAGGG - Intergenic
935551580 2:104463436-104463458 GCTACTATACTGAATACTGTAGG + Intergenic
936289118 2:111205855-111205877 GCTACTATACTGAATACTGTAGG - Intergenic
937098587 2:119251326-119251348 CCTCCTAATCTGCAGACTCAGGG - Intronic
938124556 2:128662593-128662615 TCTCCTACACTGAAGACAAAAGG + Intergenic
940250659 2:151672393-151672415 CCTCGTATGCTCAAGACTCATGG + Exonic
940391248 2:153135061-153135083 CCTGCTGTTCTGGAGACTGAAGG + Intergenic
941288123 2:163640768-163640790 CCTCTTATACTAAAGACAAAAGG + Intronic
941575059 2:167219754-167219776 CATCAGAAACTGAAGACTGAGGG - Intronic
941762522 2:169260663-169260685 CCTCCTAAACTGGGGAATGAGGG - Intronic
943230131 2:185240026-185240048 ACTTCTATAATGAAGCCTGATGG - Intergenic
943587457 2:189758264-189758286 CCAGCTATTCTGAAGGCTGAGGG + Intronic
944321006 2:198342248-198342270 ACTCCTATACTGAACACTGCAGG - Intronic
945252653 2:207777469-207777491 CTTCCTATACTAAACCCTGATGG - Intergenic
1169851184 20:10053231-10053253 CCTCCTATACTGAAGACTGAAGG + Exonic
1173169832 20:40715055-40715077 CCTCCTCTGCTGAAGGCTGGAGG + Intergenic
1173211120 20:41032641-41032663 CTTCTTAGACTAAAGACTGATGG - Intronic
1173319484 20:41974650-41974672 CCTCCTCAACTAACGACTGATGG - Intergenic
1174093741 20:48070637-48070659 CCTCCTTTACATAAGACAGAAGG + Intergenic
1180015385 21:45079031-45079053 CCTCCACTACTGCAGACTGGAGG + Intronic
1182867550 22:33617211-33617233 CATCCTATACTCAAGACTAACGG + Intronic
1184507497 22:44913342-44913364 CCTCCTAGACTCAGGACAGAGGG + Intronic
952654993 3:35774967-35774989 GTTCCTAAACTGAGGACTGAAGG + Intronic
953355371 3:42251822-42251844 GCTCCCATACTGAGGACGGAAGG + Intergenic
960685063 3:120287239-120287261 TCTGCCAGACTGAAGACTGAAGG - Intergenic
963377133 3:144482235-144482257 ACTACTATACTGAATACTGTAGG - Intergenic
967422892 3:189293364-189293386 CCTCCTGCACTGAAAACTGAGGG + Intronic
967969358 3:194987794-194987816 CCTGCTAGACTGACGTCTGAGGG - Intergenic
971620013 4:28844326-28844348 CCTCCAACACTGAAGACTACAGG - Intergenic
975886448 4:78971814-78971836 AGGACTATACTGAAGACTGAGGG - Intergenic
982430695 4:155318627-155318649 TCTCCTATAATAAAGACAGAAGG - Intergenic
983198741 4:164837870-164837892 TCTCCTACTCTAAAGACTGATGG - Intergenic
984411334 4:179401783-179401805 CATGCTAAACTGAACACTGAAGG - Intergenic
989049139 5:37301478-37301500 CATCCTGTACAGAAGAATGATGG + Exonic
990173213 5:53078302-53078324 CATCCAATAATGAACACTGAAGG + Intronic
990870678 5:60428473-60428495 GCTACTATACTGATGCCTGAAGG + Intronic
991009115 5:61863907-61863929 CATCATATATTGAAGATTGAAGG - Intergenic
996536230 5:124580934-124580956 CCAACTGTCCTGAAGACTGAGGG - Intergenic
999437720 5:151576931-151576953 CCTACTCTACTGAATACTGTAGG + Intergenic
999771206 5:154777142-154777164 GTTCCTATACTGAATACTGTAGG + Intronic
1000053581 5:157583064-157583086 CCTACTGTACTGAATACTGTAGG + Intergenic
1000420724 5:161035234-161035256 CATCCTATTCTGGATACTGAGGG - Intergenic
1003752200 6:9071517-9071539 GCTCCTGTACTGAATACTGTAGG - Intergenic
1004898753 6:20174407-20174429 CTTACTATACTGAACACTGCAGG + Intronic
1006566854 6:34966873-34966895 ACTCCTGTACTGGTGACTGAAGG - Intronic
1006998695 6:38287539-38287561 GTTACTATACTGAAGACTGTAGG - Intronic
1008435270 6:51468519-51468541 CTTCCTATAATTTAGACTGATGG + Intergenic
1008899450 6:56594980-56595002 CCTGCTTCCCTGAAGACTGAGGG - Intronic
1009476939 6:64104287-64104309 CCTCTTGTACTGAAATCTGATGG + Intronic
1013375297 6:109508902-109508924 CCTCCTTTGTTGAAGTCTGAAGG + Intronic
1016320122 6:142833419-142833441 CATCCTATACTGCAAACTGAAGG + Intronic
1017048857 6:150372032-150372054 ACTCCTTTACTGAAGACACATGG + Intronic
1017296744 6:152805056-152805078 CTTTCTAAACTGAAGAGTGAAGG + Intergenic
1022886122 7:34645753-34645775 TCACCTAGACTGAAGACTGTAGG - Intergenic
1023207484 7:37766438-37766460 CCTGCTTTGCTGAAGACAGAGGG + Intronic
1024277034 7:47686141-47686163 TGTACTATACTGAATACTGAAGG + Intergenic
1025477578 7:60944931-60944953 ACTACTATACTGAATACTGCAGG - Intergenic
1025554548 7:62288729-62288751 ACTACTATACTGAATACTGCAGG + Intergenic
1025560233 7:62364545-62364567 ACTACTATACTGAATACTGCAGG - Intergenic
1028577800 7:92371560-92371582 TCTCCAATACAGAAGAATGAAGG + Exonic
1029915593 7:104206837-104206859 GCTACTATACTGAATACTGTAGG - Intronic
1029955511 7:104634659-104634681 TCTCCTAAGCTGAAGACTGTGGG + Intronic
1032359916 7:131245655-131245677 GCTCCTGTACTGAATACTGTAGG - Intronic
1035832492 8:2712334-2712356 CGTCCTCTAGTGAAGACTGTTGG - Intergenic
1038961859 8:32529155-32529177 GCTACTATACTGAACACTGTAGG + Intronic
1040858809 8:51977980-51978002 CCTGATATATTGAAGACTGCTGG + Intergenic
1041443847 8:57928743-57928765 CCTGCTATAATCAAGACTCAGGG - Intergenic
1041468008 8:58177250-58177272 GCTACTATACTGAATACTGTAGG - Intronic
1044885856 8:96776306-96776328 CATTCTAGACTGAAGACTGAGGG + Intronic
1045016907 8:98008266-98008288 TCTCCTTTACTGAAGAATGCTGG + Intronic
1045346096 8:101294953-101294975 CCTCCCAAACTGAAGCCTGGGGG - Intergenic
1048296290 8:133216965-133216987 TCCCCCATACTGAAGAGTGAGGG + Intronic
1048357048 8:133662278-133662300 CTTCCTCTTCTGAAGCCTGAAGG + Intergenic
1050093906 9:2043871-2043893 ACTCCTAAAATGAGGACTGAAGG + Intronic
1050525811 9:6545320-6545342 CCTACTGTACTGAATACTGTAGG + Intronic
1052101119 9:24447300-24447322 TGTCCTATACAGAAGACAGATGG - Intergenic
1056023136 9:82462639-82462661 CCTCCTATACTGGAGATGAAAGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057709427 9:97425414-97425436 GCTACTATACTGAATACTGTAGG - Intronic
1058842125 9:108920071-108920093 CCTCCTTTACTGAAGGGTTAAGG + Intronic
1059306473 9:113357109-113357131 CCTCCTATTGAGAAGACAGAAGG + Intronic
1061447693 9:130650535-130650557 CCCCCTAGACTGAAGACTCTAGG - Intergenic
1187272891 X:17794571-17794593 CCTCCTATCCTCAAGACTCAAGG - Intergenic
1191949471 X:66572580-66572602 CCTGCCATACTGACCACTGAGGG - Intergenic
1195394042 X:104391916-104391938 ACTCCTATACTAGAGACTGCAGG - Intergenic
1197447940 X:126574974-126574996 CCTACTCTACTGATGAGTGATGG + Intergenic
1198436002 X:136617456-136617478 CCCCTTTTACTGAACACTGAGGG - Intergenic
1201390422 Y:13491043-13491065 CCTGCTATGCTTAAGACTCATGG + Intergenic