ID: 1169853399

View in Genome Browser
Species Human (GRCh38)
Location 20:10077731-10077753
Sequence CACATGACTGTGGCTTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169853396_1169853399 18 Left 1169853396 20:10077690-10077712 CCATATTGCCTATGATGTTTTAC No data
Right 1169853399 20:10077731-10077753 CACATGACTGTGGCTTCCTAAGG No data
1169853397_1169853399 10 Left 1169853397 20:10077698-10077720 CCTATGATGTTTTACTCTAATGT No data
Right 1169853399 20:10077731-10077753 CACATGACTGTGGCTTCCTAAGG No data
1169853395_1169853399 19 Left 1169853395 20:10077689-10077711 CCCATATTGCCTATGATGTTTTA No data
Right 1169853399 20:10077731-10077753 CACATGACTGTGGCTTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169853399 Original CRISPR CACATGACTGTGGCTTCCTA AGG Intergenic
No off target data available for this crispr