ID: 1169855795

View in Genome Browser
Species Human (GRCh38)
Location 20:10101275-10101297
Sequence GTGTTGTAAGATGTCACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169855794_1169855795 0 Left 1169855794 20:10101252-10101274 CCTTGTTGTGATATTACACTACA No data
Right 1169855795 20:10101275-10101297 GTGTTGTAAGATGTCACCACTGG No data
1169855793_1169855795 23 Left 1169855793 20:10101229-10101251 CCTGGCTGCATCAATATCAATAT No data
Right 1169855795 20:10101275-10101297 GTGTTGTAAGATGTCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169855795 Original CRISPR GTGTTGTAAGATGTCACCAC TGG Intergenic
No off target data available for this crispr