ID: 1169869994

View in Genome Browser
Species Human (GRCh38)
Location 20:10239887-10239909
Sequence GGTTCCAGAAAGGCCCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169869994 Original CRISPR GGTTCCAGAAAGGCCCCTGT AGG (reversed) Intronic
901491239 1:9597395-9597417 GGTTCCAGGTGGGGCCCTGTTGG + Intronic
901529218 1:9843116-9843138 GGTTCCAGATAGAACCCTGAGGG + Intergenic
901932067 1:12602269-12602291 GGTTGCAGAAAGGCCTATGTTGG + Intronic
902193360 1:14779347-14779369 GGCTCCAGAAAAGCCCCAGAGGG - Intronic
904046228 1:27610325-27610347 GGTACCAGACAGAGCCCTGTAGG + Intergenic
904147272 1:28403257-28403279 GGGTCCACTAAGGCTCCTGTTGG - Intronic
904377421 1:30090533-30090555 GCTTCCAGAGAGGCCCCTGGGGG + Intergenic
905561331 1:38929574-38929596 GGTACCAGGCAGGCCCCTGCCGG + Intronic
905615004 1:39390397-39390419 TGTTTCAGAAGGGCCCCTCTAGG + Intronic
905668644 1:39777469-39777491 GCTTCCAGGAAAGGCCCTGTGGG + Intronic
907932727 1:59015541-59015563 GTTTCAAGAGAGGCCCATGTGGG + Intergenic
908205508 1:61844187-61844209 GGATCCAGAGAGGCCCCAGGGGG + Intronic
909090885 1:71224127-71224149 AGTTCCAGAATGGCCCCTTTTGG + Intergenic
910673943 1:89799022-89799044 GGTTCCAGAAGGTCTCCTGCAGG - Intronic
912074095 1:105850582-105850604 GGTTCCATAAAGTCCCCAGTGGG + Intergenic
912397513 1:109358222-109358244 GGTTCTAGCAAGGCCACTTTGGG + Intronic
913247911 1:116886580-116886602 GGTATCAGAAAGGCCTCTGTGGG - Intergenic
917680872 1:177366078-177366100 ACCTCTAGAAAGGCCCCTGTTGG - Intergenic
922077886 1:222266136-222266158 GGATCCAGGAAGGCCCATGGAGG - Intergenic
922249291 1:223832929-223832951 GGTTCCACAGAGACCCCTGTGGG - Intronic
924615471 1:245608389-245608411 AGCTCCAGCAAGGCCTCTGTTGG - Intronic
1063106076 10:2993612-2993634 GCTTCCAGAAAGGCAGCTTTGGG + Intergenic
1063672362 10:8109547-8109569 GGTTCCTGAAAGGCACCTTCTGG - Intergenic
1064717654 10:18193531-18193553 GATTCCAGAAGGGCCTCTGCAGG + Intronic
1068228878 10:54143944-54143966 GGTTCCAGAAAAGCCAGTGTAGG + Intronic
1068724976 10:60290724-60290746 TGTGCCAGAAAGGCCCCTGCTGG + Intronic
1070179410 10:73999163-73999185 GAGTCTAGAAAGGCCCCAGTGGG - Intronic
1070758097 10:79005912-79005934 GGTCCCAGCAGGGCCCCTGAAGG - Intergenic
1073460967 10:103665712-103665734 GGATCCAGAGTGGCCTCTGTGGG - Intronic
1074049246 10:109867396-109867418 GGTATCAGCAAGGCCCATGTGGG + Intronic
1074327642 10:112468187-112468209 GGTTGCAGAAAGGCCACCGGAGG + Intronic
1074619910 10:115107912-115107934 GTTTCCAGAAAGGCATCTATGGG - Intronic
1076112602 10:127872451-127872473 ACTTCCACAAGGGCCCCTGTGGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1079108630 11:17590668-17590690 GGGTCCAATAAGGCCACTGTAGG - Intronic
1079338216 11:19589827-19589849 GGTTCCAGAAGGCACACTGTAGG + Intronic
1083791740 11:64990129-64990151 GGTTGCTGAATGGCTCCTGTGGG - Intronic
1084431640 11:69114583-69114605 GGCCCCAGAAGGACCCCTGTAGG - Intergenic
1084488205 11:69463416-69463438 GTTTCCAGAAAAGCTTCTGTGGG - Intergenic
1086946296 11:92847028-92847050 GATTCAAGAAAGGGCCCTCTTGG + Intronic
1088011012 11:105001091-105001113 TGGTCCAGAAAAGCCTCTGTGGG - Intronic
1088098944 11:106132603-106132625 AGGACCAGAAAGGCACCTGTAGG - Intergenic
1090204520 11:124877139-124877161 GCTTCCAGAAAGGAACCCGTGGG - Exonic
1095612491 12:44146432-44146454 GCTTACAGAAAGGCCCCAGGGGG - Intronic
1095909124 12:47408095-47408117 GGTCCAAGAAAGGGCCCTGTGGG + Intergenic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1101979049 12:109389465-109389487 GGTTCCCCAAAGGACTCTGTTGG + Intronic
1106632603 13:31491767-31491789 TGTGGCAGAAAGGCTCCTGTAGG + Intergenic
1107457896 13:40571586-40571608 AGTTTCAGGAAGGCCCCTTTAGG - Intronic
1108384745 13:49888981-49889003 GGTTCCAGCAAGGCCAATTTAGG + Intergenic
1109126663 13:58526997-58527019 GGTTCCAGCAAGGCCAATTTAGG + Intergenic
1112382854 13:98909342-98909364 GTTTCCAGAAAGTCTGCTGTAGG + Intronic
1113748455 13:112762368-112762390 GGGACCTGAAAGGCCGCTGTTGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1116372550 14:44154592-44154614 GGCTCCAGGTTGGCCCCTGTAGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1125828141 15:42693037-42693059 GGTTTCAGAAAGCCCCCGTTGGG + Exonic
1128254460 15:66186486-66186508 GTTTCCAGAAAGGAGACTGTAGG + Intronic
1128359101 15:66948264-66948286 GTATCCAGAGAGGCGCCTGTGGG + Intergenic
1131989238 15:98077221-98077243 TGTTCCAGAATGGGCCCTGCGGG - Intergenic
1132611193 16:817099-817121 GCCTCCAGAAAGGCCGCTGCGGG - Intergenic
1132796749 16:1728210-1728232 GGGGCCAGAGAGGCCCGTGTTGG + Intronic
1132939715 16:2500697-2500719 GGTTTCAGAGAGGCCCGTGCAGG + Intronic
1133018231 16:2954819-2954841 GGTTCCAGACAAGTCCCTGTGGG + Intergenic
1135494801 16:22942017-22942039 AGTTCCAGGAAGGTACCTGTGGG + Intergenic
1139163596 16:64539892-64539914 GTTTCCAGAGAGACACCTGTGGG + Intergenic
1142474106 17:179864-179886 GGTTAGAGCAGGGCCCCTGTAGG - Intronic
1143781006 17:9229786-9229808 GCTTCCAGGAAGACCCCTGATGG + Intronic
1144354234 17:14428855-14428877 GGCTCCACCAGGGCCCCTGTGGG - Intergenic
1147211799 17:38876123-38876145 GGTTCCACAAAGACCCCTCCAGG + Intronic
1151366122 17:73617441-73617463 GGAGCCAGAAGGGCCCCTGGGGG - Intronic
1152325276 17:79632406-79632428 GTTTCCAGAGGGACCCCTGTTGG + Intergenic
1155557215 18:27033140-27033162 TATTCCAGAAAGGCAGCTGTTGG + Intronic
1157685585 18:49640232-49640254 GAACCCAGAAAGGTCCCTGTGGG + Intergenic
1162461292 19:10815806-10815828 GGTGCCAGCAAGTCCCCAGTGGG - Intronic
1163415378 19:17183326-17183348 GGTTCCAGAAGGGCCTCTGTGGG + Intronic
1163812467 19:19442254-19442276 TGTGCCAGCAGGGCCCCTGTGGG - Intronic
1165252985 19:34555499-34555521 GGTTGCAGAAAGGACACTGCAGG + Intergenic
1165319350 19:35075948-35075970 GGACCCAGGGAGGCCCCTGTGGG - Intergenic
1166901525 19:46067599-46067621 GGATGCAGACAAGCCCCTGTGGG - Intronic
1167408900 19:49333554-49333576 GGTTTCAAAAAGACCCCTCTGGG + Intergenic
1167573761 19:50307360-50307382 GCATCTAGAAAGGGCCCTGTAGG + Intronic
925146673 2:1587206-1587228 GGTTCCAGGGAGGGCCCTGTGGG - Intergenic
925211111 2:2047439-2047461 GGTTCTAGAATGGCCACTGGGGG - Intronic
925309588 2:2873011-2873033 GCTTCCAGTAAAGCCACTGTTGG + Intergenic
925366180 2:3313738-3313760 GGTTTCAGAAAAGTCACTGTAGG + Intronic
925676259 2:6364593-6364615 GGTTCCAGCAAGGCTCCATTTGG + Intergenic
926767449 2:16334693-16334715 GGTTCCACTAAAGCCTCTGTTGG - Intergenic
931152020 2:59585126-59585148 GGATCCAGAATGCCCCCTGGTGG + Intergenic
933412268 2:81941007-81941029 GGTTCCAGACAGCACTCTGTGGG - Intergenic
938085427 2:128396753-128396775 AGATCCAGACAGGCCTCTGTGGG + Intergenic
943509371 2:188804693-188804715 GCTTGCAGAAAGCCTCCTGTGGG + Intergenic
945132300 2:206585961-206585983 GGTTCTATAAAGGCCTCTTTGGG + Intronic
945162532 2:206907824-206907846 GGATCCAGCAATCCCCCTGTGGG + Intergenic
946686870 2:222279444-222279466 CCTTCCATAAAGGGCCCTGTGGG - Intronic
947936481 2:234009139-234009161 GATTCCAGATAGGTCCCTCTTGG - Intronic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
949046035 2:241873093-241873115 GGTTCCACAAGGCCCGCTGTGGG + Exonic
1169869994 20:10239887-10239909 GGTTCCAGAAAGGCCCCTGTAGG - Intronic
1170063446 20:12285080-12285102 GGTTAGAGAAATGCCACTGTTGG - Intergenic
1171030683 20:21673862-21673884 GAATCCAGAAAGGCCACTGTGGG + Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1173987961 20:47277422-47277444 GGTTCCAGAAAAGCTGCTGCTGG - Intronic
1174418220 20:50381882-50381904 GATTCCAGCAAGGTGCCTGTAGG + Intergenic
1175278841 20:57789029-57789051 GATTCGAGGAAGGCACCTGTGGG + Intergenic
1178894305 21:36546002-36546024 GTTTCCTGAAAGGCAGCTGTTGG - Intronic
1179231279 21:39506111-39506133 GGTTCCAGAAAGTGGCCTGGAGG + Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180636903 22:17269017-17269039 AGCTTCAGAAAGGCCGCTGTGGG + Intergenic
1181030402 22:20146737-20146759 GGTTCCTGAGAGTCCCCTGTGGG - Intronic
1183420528 22:37709188-37709210 GGTTCCAAGAAGGCCACTGCTGG - Intronic
1183547622 22:38463283-38463305 AGCACCAGAAAGGCCCCTGGAGG + Intergenic
1184179983 22:42814619-42814641 GGTCACTGACAGGCCCCTGTGGG - Intronic
1184670256 22:46008487-46008509 TGGTCCAGAAAGGCCTCTGGAGG - Intergenic
1184906893 22:47494163-47494185 GGTTTCAGAAGGGGGCCTGTGGG - Intergenic
951720086 3:25689085-25689107 TGGTCAAGAAAGGCCCCTTTAGG + Intergenic
952751941 3:36831743-36831765 GGTTCCCGAGAGGCTCCTGAAGG - Exonic
953414033 3:42705404-42705426 GGTGCCCCAGAGGCCCCTGTGGG + Intronic
955392882 3:58534130-58534152 GTCTCCAGAAAGGGCTCTGTTGG + Exonic
955871283 3:63441400-63441422 GTTTCCAGCAATGCACCTGTAGG - Intronic
956892967 3:73630421-73630443 GCTTCCAGAAAAGCTCCTGAAGG - Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
959063881 3:101638443-101638465 GGTTGCAGAAAGGACACTGCAGG - Intergenic
966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG + Intergenic
968548086 4:1208614-1208636 GGTTCCAGCAGGGCCCTTGGAGG + Exonic
969927514 4:10598929-10598951 GGTACCTGAAAGGGCCCCGTGGG - Intronic
973552752 4:52051833-52051855 GGTTCCAGCACAGCCCTTGTCGG + Intronic
974546659 4:63318246-63318268 GGATCCAGAAAGCCCACTTTTGG + Intergenic
977067233 4:92333365-92333387 GTTTCCAGAAAGGCACCTGTGGG - Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985713100 5:1441475-1441497 GGGACCAGGAAGGCACCTGTGGG + Exonic
985822579 5:2170190-2170212 GGTCCCACAAAGGCTCCTGGTGG + Intergenic
986400372 5:7373137-7373159 GGTTCCTGATAGGCCCCTCAAGG + Intergenic
990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG + Intergenic
992805376 5:80332131-80332153 AGCTCCAGAAGGGCTCCTGTGGG - Intergenic
994415494 5:99464676-99464698 GCCCCCAGAAAGGCCCCAGTGGG - Intergenic
996915106 5:128703107-128703129 GTTTCCAGAGAGGCTCCTGTGGG + Intronic
999276705 5:150336063-150336085 GAATCAAGAAGGGCCCCTGTGGG + Intronic
1001752428 5:174141875-174141897 GGTTCCAGAAAGGGCTGTCTTGG + Intronic
1003361092 6:5425874-5425896 GTTTCAAGAAAAGACCCTGTGGG - Intronic
1010328075 6:74588108-74588130 GGTACCAGAAAGGCCACAGATGG + Intergenic
1010989827 6:82468334-82468356 GGTTCCAGCAAAGCCACTTTAGG + Intergenic
1016642133 6:146361193-146361215 GGCTCCAGAACTGCCCCTGTTGG - Intronic
1019151181 6:170006993-170007015 GATTCCAGAATGACCTCTGTGGG - Intergenic
1020115296 7:5472823-5472845 GGGTCCAGAACGGCCACTGTGGG - Intronic
1020264892 7:6553707-6553729 GGCTCCAAAAAGCCCTCTGTAGG - Intergenic
1022304141 7:29130345-29130367 TATTCCATAAAGGACCCTGTGGG - Intronic
1022355290 7:29609052-29609074 GGCTTCAGAAAGGACCCTGACGG + Intergenic
1023648499 7:42344204-42344226 GGTCCCAGTAAGGACCCAGTGGG + Intergenic
1024547966 7:50538256-50538278 GGGTCCAGAAAGCCCACTGGTGG + Intronic
1026127762 7:67594494-67594516 GGACCCAGAAAGGACCCAGTGGG - Intergenic
1034002664 7:147432806-147432828 GGTTTAGGAAAGGCCTCTGTAGG - Intronic
1038236551 8:25763250-25763272 GGTTCCAGAAAGGTCCTTTTAGG + Intergenic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1044256494 8:90069613-90069635 GGTCACAGAAAGGCACATGTGGG + Intronic
1045683669 8:104689361-104689383 GGTTAGAGAAAGGCCTCTCTGGG + Intronic
1046021129 8:108666456-108666478 GGGTCCAGGAAGCCCCCTGGTGG - Intronic
1048807232 8:138252096-138252118 GGTACCAGAAAGAAACCTGTCGG + Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1057170644 9:92961086-92961108 GGTCCCACACAGGCCCCTCTGGG + Intronic
1058702488 9:107612604-107612626 GGTTTCAGAGAGGCCCCCATGGG - Intergenic
1060421404 9:123472248-123472270 GGTCCAAGAAAGGCCACTGGGGG + Intronic
1061280087 9:129592994-129593016 GGTTGAAGAGAGTCCCCTGTGGG + Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1188773150 X:34179377-34179399 GTGTCCAGAAAGACCTCTGTTGG - Intergenic
1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG + Intergenic
1192184070 X:68934665-68934687 GGGTCCTGAAAGACCTCTGTGGG - Intergenic
1195210997 X:102652083-102652105 GATTCCGGAAAGGGGCCTGTGGG + Intronic
1195217148 X:102713035-102713057 GATTCCCGAAAGGGGCCTGTGGG + Intronic
1195221273 X:102746624-102746646 GATTCCGGAAAGGGGCCTGTGGG + Intronic
1196014120 X:110919358-110919380 GGTTCAAGAAAGCCACCTCTGGG - Intergenic
1198610021 X:138388245-138388267 GGTTCTAGATATGCCCTTGTTGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic