ID: 1169873448

View in Genome Browser
Species Human (GRCh38)
Location 20:10271490-10271512
Sequence TTAGAGCAGGACAAAGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 216}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169873440_1169873448 10 Left 1169873440 20:10271457-10271479 CCTCCTCCCAAATCACAGACGTA 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG 0: 1
1: 0
2: 1
3: 22
4: 216
1169873438_1169873448 24 Left 1169873438 20:10271443-10271465 CCAGATTCATCAGCCCTCCTCCC 0: 1
1: 1
2: 2
3: 18
4: 252
Right 1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG 0: 1
1: 0
2: 1
3: 22
4: 216
1169873443_1169873448 3 Left 1169873443 20:10271464-10271486 CCAAATCACAGACGTATCTCCAT 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG 0: 1
1: 0
2: 1
3: 22
4: 216
1169873437_1169873448 27 Left 1169873437 20:10271440-10271462 CCACCAGATTCATCAGCCCTCCT 0: 1
1: 0
2: 0
3: 14
4: 241
Right 1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG 0: 1
1: 0
2: 1
3: 22
4: 216
1169873441_1169873448 7 Left 1169873441 20:10271460-10271482 CCTCCCAAATCACAGACGTATCT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG 0: 1
1: 0
2: 1
3: 22
4: 216
1169873442_1169873448 4 Left 1169873442 20:10271463-10271485 CCCAAATCACAGACGTATCTCCA 0: 1
1: 0
2: 0
3: 3
4: 115
Right 1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG 0: 1
1: 0
2: 1
3: 22
4: 216
1169873439_1169873448 11 Left 1169873439 20:10271456-10271478 CCCTCCTCCCAAATCACAGACGT 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG 0: 1
1: 0
2: 1
3: 22
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169873448 Original CRISPR TTAGAGCAGGACAAAGGTGT GGG Intronic
901593833 1:10369160-10369182 ATAAAGCAGGAAAGAGGTGTAGG - Intronic
901634666 1:10664977-10664999 TTAGAGCAGGAGTGAGGAGTCGG + Intronic
902648132 1:17818327-17818349 TTACAGGAGGTGAAAGGTGTGGG - Intronic
903181989 1:21609527-21609549 GCAGAGCAGGACAAATGGGTGGG - Intronic
905496333 1:38391007-38391029 TGAGAGCAGGAGAAAGATGTAGG + Intergenic
905935105 1:41817266-41817288 CTAGGTCAGGACAAAGGTGATGG + Intronic
906109136 1:43311846-43311868 CTGGGGCAGGACAGAGGTGTTGG + Intronic
907484129 1:54765323-54765345 TTAGAGAAGGAGAATGGAGTGGG + Intergenic
907874951 1:58476764-58476786 TTAAATCAGGGAAAAGGTGTTGG + Intronic
908332646 1:63085717-63085739 ATAGAGCAGAGCACAGGTGTGGG - Intergenic
910091963 1:83475134-83475156 TTACAACAGGACCAAGGTCTAGG - Intergenic
911036177 1:93550997-93551019 ATAGAGGAGGACAAAGGTGACGG + Exonic
911176468 1:94822570-94822592 TTAGGGCTGGACAAAGGCTTGGG + Intronic
914197633 1:145457447-145457469 TTATAACAGGACACAGGTGGAGG + Intergenic
914323944 1:146592667-146592689 TCAGAGAAGCAGAAAGGTGTGGG + Intergenic
914324055 1:146593922-146593944 TCAGAGAAGCAGAAAGGTGTGGG - Intergenic
914476737 1:148030559-148030581 TTATAACAGGACACAGGTGGAGG + Intergenic
914503481 1:148267282-148267304 TTATAACAGGACACAGGTGGAGG - Intergenic
914697274 1:150096289-150096311 TTGGATCATGACAAAGGTATTGG + Intronic
914952283 1:152126844-152126866 TTAGAGAAGGGCACAGGTGGTGG + Intergenic
914978207 1:152386954-152386976 TTTAAGCTGGACAAAGTTGTTGG + Intergenic
915148855 1:153812770-153812792 TTAGAGAAGGAAAAATGTGTTGG - Intronic
916676723 1:167070142-167070164 TTGGAGTAGGATAAAGGTGTTGG + Intronic
916814189 1:168335738-168335760 GTAGGACAGGAGAAAGGTGTAGG + Intergenic
918663023 1:187113219-187113241 GTAGAGAAGGACAATGGTATGGG - Intergenic
921080728 1:211736888-211736910 AGAAAGCAGGACAAAGGGGTGGG - Intergenic
921542359 1:216431632-216431654 TGGGAGCAGGACAAAGAGGTGGG + Intergenic
923612515 1:235507333-235507355 TTAGAGCAGCACAAAGCAGGGGG + Intergenic
1062978810 10:1704889-1704911 TTTGAGCAGGAAAAGGGTGCAGG + Intronic
1066056323 10:31684256-31684278 TGAGAACAGGACAAAGGAGGGGG + Intergenic
1070279084 10:75035837-75035859 TGAGAGCATGAGGAAGGTGTGGG + Intergenic
1074234020 10:111566620-111566642 TTAGTGCAAGCCCAAGGTGTTGG - Intergenic
1075043689 10:119128777-119128799 CTGGAGCAGGAGAAAGGTGGGGG + Intronic
1075748894 10:124747887-124747909 TTGTAGCTGGACAAAGATGTGGG - Intronic
1076169527 10:128307900-128307922 AGAGAGAAGGACAAAGGTGGAGG - Intergenic
1076204484 10:128585762-128585784 ATAGAGTATGGCAAAGGTGTTGG + Intergenic
1077433668 11:2528128-2528150 TCAGGGCAGGACCAATGTGTGGG - Intronic
1080221504 11:29910737-29910759 TCAGCACAGGAGAAAGGTGTAGG - Intergenic
1081949852 11:47034955-47034977 TTAAAGCAGAAGAAAGGTGAAGG - Intronic
1082771747 11:57213335-57213357 CAAGACCAGGACAAAGGGGTTGG - Intergenic
1086092678 11:83020293-83020315 TTAGAGCAGGCATAAGGAGTGGG - Intronic
1090726355 11:129530554-129530576 AGAGAGCAGGACAAGGGTGGAGG + Intergenic
1090857941 11:130627081-130627103 AAAAAGAAGGACAAAGGTGTAGG + Intergenic
1091180243 11:133597660-133597682 TTAGAGCCAAACACAGGTGTTGG - Intergenic
1091617410 12:2059932-2059954 TTAAGGCAGTACAAAGGTGGAGG - Intronic
1091909098 12:4214442-4214464 TTAATGCAGGATAAAGATGTTGG - Intergenic
1092524018 12:9298575-9298597 GACGAGCAGGACAAAGTTGTGGG - Intergenic
1092543252 12:9433239-9433261 GACGAGCAGGACAAAGTTGTGGG + Intergenic
1092760316 12:11804668-11804690 ATAGTGCAGGATAAAGGTGATGG - Intronic
1092951400 12:13507003-13507025 TTTGAGCAGAACAAAGTCGTGGG - Intergenic
1092973943 12:13725832-13725854 TCAGAGCAGGACACAGGGATGGG + Intronic
1095579650 12:43782838-43782860 ATAGAGCAAGAGATAGGTGTGGG + Intronic
1096902509 12:54900005-54900027 TTGGAGCAGGAGAAAGGTGGCGG + Intergenic
1097947716 12:65390280-65390302 TTAGAAGAGGACAAAGCTGAAGG - Intronic
1100522405 12:95387998-95388020 TTAGAGAAGCAGAAAGCTGTAGG + Intergenic
1101536453 12:105622256-105622278 TTAAAACAGGAAAAAGTTGTAGG + Intergenic
1102396277 12:112588981-112589003 TTAGGGGAGGAGAAAGGAGTGGG + Intronic
1103230551 12:119326915-119326937 TGGGAGCAGGACCAAGGTGGGGG - Intergenic
1103862570 12:124026352-124026374 TTGGAGTAGGTCCAAGGTGTTGG + Intronic
1104463630 12:128973574-128973596 TTAGAGCAGGAGGAAGTTGGAGG - Intronic
1105272068 13:18886222-18886244 GGAGAGAATGACAAAGGTGTGGG + Intergenic
1107249507 13:38341441-38341463 TTAGGGCAGGGAAAATGTGTTGG + Intergenic
1107513628 13:41108193-41108215 TTAGAACAGGTCAGAGGAGTGGG - Intergenic
1107985996 13:45776649-45776671 TGAGAGCAGGAAACAGGTCTTGG + Intergenic
1109101653 13:58192028-58192050 ATAGAACATGACAAAGGTGAAGG - Intergenic
1109993517 13:70090391-70090413 CTACAACAGTACAAAGGTGTAGG + Intronic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1113032455 13:106009381-106009403 TTAGTCCAAGACAAACGTGTAGG + Intergenic
1114781312 14:25541142-25541164 TTAGAACAGGGCAAAAGTATAGG + Intergenic
1116331706 14:43604894-43604916 TTACAGCAAGAGAAAGGAGTAGG + Intergenic
1122285883 14:100652352-100652374 TTAGACCAGGCCAAATGTTTTGG - Intergenic
1124213663 15:27786220-27786242 TTGAAGAAGAACAAAGGTGTAGG - Intronic
1125078385 15:35648186-35648208 TAAGATCAGGAGATAGGTGTGGG + Intergenic
1126112142 15:45181480-45181502 TTAGGGTAGGTCAAAGGGGTCGG - Intronic
1128822188 15:70667854-70667876 TCAGAGCATGAGAAAGGTGCAGG - Exonic
1129951550 15:79596525-79596547 TCAGAGCAGGACCTAGCTGTTGG - Intergenic
1138276484 16:55738531-55738553 GTAGAGCAGAACAAAGGTCCTGG + Intergenic
1138277576 16:55747192-55747214 TTAGAGCAGGAGGAAGCTGGGGG - Intergenic
1138277628 16:55747511-55747533 TTAGAGCAGGAAGAAGCTGGGGG - Intergenic
1138567678 16:57845500-57845522 TAGGAGCAGAGCAAAGGTGTTGG - Intronic
1138733126 16:59218078-59218100 TTAAAGAAGGACAATGGTGGAGG - Intergenic
1140009507 16:71116921-71116943 TCAGAGAAGCAGAAAGGTGTGGG + Intronic
1140009618 16:71118177-71118199 TCAGAGAAGCAGAAAGGTGTGGG - Intronic
1141424888 16:83938435-83938457 TCAGAGCAGGACAGAGGAGGTGG + Intronic
1144159048 17:12539135-12539157 TTAGGGAAGGACAAAGGAGTTGG + Intergenic
1147026011 17:37584095-37584117 TTAGAGCAGGGTAAAGGGATTGG - Intronic
1147637088 17:41970722-41970744 TTAGAGCAGGAGAAATGTAATGG + Intronic
1153980466 18:10304527-10304549 TCAGAGCAGAACAGAGGTGGGGG - Intergenic
1155226976 18:23737456-23737478 TCATAGCAGAACAAATGTGTGGG - Intronic
1155317031 18:24582140-24582162 TTAGGGCAGGCAAAAGCTGTCGG + Intergenic
1155609673 18:27651614-27651636 TTACAGCAAGACAAAGTTGAAGG - Intergenic
1155904575 18:31434093-31434115 TTAGAGAAGGAAAAAGTTGGAGG + Intergenic
1156154575 18:34286982-34287004 TGAGAGCAGGAGCAAGGTGTAGG + Intergenic
1156191940 18:34730367-34730389 TTAAAGCAGTACACAGTTGTTGG + Intronic
1157962861 18:52176169-52176191 TGGGAGCAGAACAAACGTGTAGG + Intergenic
1158368592 18:56770728-56770750 ATAGGGCAGTACAAAGGTGCAGG - Intronic
1159378128 18:67620760-67620782 TCAGAACAGGAGAAAGGTGGAGG - Intergenic
1159702784 18:71650297-71650319 TGGGAGCAGGAGCAAGGTGTGGG - Intergenic
1163269888 19:16246553-16246575 TTAGAACAGGACACATGTCTAGG + Intergenic
1163295111 19:16406664-16406686 TCTGGGCAGGCCAAAGGTGTTGG - Intronic
1163520533 19:17788981-17789003 TATGAGCAGGACAAAGTTCTTGG + Intergenic
1163643418 19:18474609-18474631 TTGGAACAGGACAAGGGAGTGGG - Intronic
1164847713 19:31448672-31448694 TTGGTGCAGGACAGAGCTGTGGG - Intergenic
1165435492 19:35792674-35792696 TTAGAGCAGAACAACGCGGTGGG + Intergenic
1168701652 19:58443488-58443510 CTAGAGCTGGACAAGGGCGTGGG - Intergenic
929619513 2:43340578-43340600 TTAGGGAAGGAAAAGGGTGTCGG + Intronic
930010704 2:46936308-46936330 TTAGAGAAGAAGATAGGTGTAGG + Intronic
930033101 2:47070095-47070117 GCAGAGCAGCACAAAGGTCTAGG - Intronic
931643995 2:64405129-64405151 GTAGAGCAGGACTACTGTGTAGG - Intergenic
931909859 2:66887308-66887330 TTAGAGCAGGAAAAGAGTGATGG - Intergenic
934144801 2:89081271-89081293 TTGGAGAAGGACAAAGCTATAGG + Intergenic
934224456 2:90119280-90119302 TTGGAGAAGGACAAAGCTATAGG - Intergenic
936069196 2:109353998-109354020 TGACAGCAGGACAAAGATGCAGG + Intronic
938394403 2:130932002-130932024 TTGGAGCTGGACAGAGGTGGTGG - Intronic
939776777 2:146397652-146397674 TCAGAGCAGAACAATGATGTGGG + Intergenic
939811274 2:146835721-146835743 TTAGAGCTGTACAAAGATGGAGG + Intergenic
940134637 2:150422579-150422601 TTAGAGCAGAGCAAAGGTGATGG + Intergenic
940916585 2:159263006-159263028 TTAGAGCACCACAAAACTGTAGG - Intronic
941790036 2:169542099-169542121 TTAGAGCAGGGTAAGTGTGTAGG - Intronic
942192380 2:173483033-173483055 TTAGAAGTGGAAAAAGGTGTAGG + Intergenic
942200806 2:173569325-173569347 CTGGAGCAGAACAAAAGTGTAGG - Intergenic
942358172 2:175142140-175142162 TTAGATCAGTACAAAAGTGAAGG + Intronic
942983033 2:182105483-182105505 AGAGAGAAGGGCAAAGGTGTGGG + Intronic
943190927 2:184679592-184679614 TCAGAGCAGGCCTAAGGAGTGGG - Intronic
947023041 2:225704890-225704912 CTAGAGCAGTACACAGGTGCTGG + Intergenic
948138834 2:235658374-235658396 TTAGAGCAGTACAAAGGCCTGGG - Intronic
1169280485 20:4262898-4262920 TCAGAGTAGGGCAAAGGGGTTGG + Intergenic
1169291321 20:4355545-4355567 CTAGAGCAGGAGCAAGGGGTTGG - Intergenic
1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG + Intronic
1170917461 20:20641495-20641517 TCAGAGCATGGCAAAGGTGTTGG - Intronic
1172762196 20:37330741-37330763 TTAAAGGAGGAGACAGGTGTTGG - Intergenic
1173420330 20:42895440-42895462 TTAGTGAATGACAAAGGTGAAGG - Intronic
1179729496 21:43359872-43359894 TTAAAGCAGGAAACAGGTCTTGG + Intergenic
1182111230 22:27725174-27725196 TCAGAGCAGGACAAGGGCCTAGG + Intergenic
1183611205 22:38907613-38907635 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1184437807 22:44490213-44490235 TAAGAGCAGGAGAAAGGAGGCGG + Intergenic
1184668687 22:46001732-46001754 TAAAAACAGGACAAAGGCGTGGG - Intergenic
1184695381 22:46135964-46135986 TCAGAGAAGGTCAAAGGTGCTGG + Intergenic
949383393 3:3470552-3470574 TTAGTGCAGGAAAAAGATGGTGG - Intergenic
950093743 3:10315855-10315877 TGGGAGCAGGCCAAAGGAGTGGG + Intronic
950912230 3:16606153-16606175 GTAGAGCAGGAGCAAGCTGTGGG + Intronic
951596152 3:24320418-24320440 TCAGGGCAGGACAAATGTTTGGG + Intronic
951826307 3:26873064-26873086 TTAGAGCAAGACAGAGTGGTGGG - Intergenic
956824376 3:72984151-72984173 TTTGAGCATGAGAAATGTGTTGG - Intronic
956938352 3:74129739-74129761 GTAGAGCATGGCAAATGTGTTGG + Intergenic
957413326 3:79868505-79868527 TTAGAGAAGAACAAAAGTATAGG - Intergenic
960050188 3:113232144-113232166 TTACAGCAGGAGCAAAGTGTGGG - Intronic
961309989 3:125990490-125990512 CTAGAGCAGGAGAAAGGGTTTGG + Intergenic
962166166 3:133050668-133050690 TTAGTGAAGGGCAAAGGGGTGGG - Intronic
962507882 3:136066660-136066682 CGAGAGCAGGAGCAAGGTGTGGG + Intronic
965350292 3:167603375-167603397 TTAGAGAAGGATAGAGGAGTTGG - Intronic
969470027 4:7382167-7382189 TCAGAGCAGGGCAAAGCTGATGG + Intronic
970168396 4:13263773-13263795 TTAGGGCAGCAAAAAGGTGCAGG - Intergenic
974475726 4:62377246-62377268 TTAGAGAAGAATAAAGGTATAGG + Intergenic
974973873 4:68865994-68866016 TTGGAGCAGGAGGAAGGTGGGGG - Intergenic
975152747 4:71038839-71038861 TTAAAGAAGAACAAAGTTGTAGG - Intergenic
977397223 4:96485935-96485957 TTAGAGCAAGAAAAGGATGTGGG + Intergenic
978407298 4:108394110-108394132 ATAGAACAGGGCAAAGGTGATGG + Intergenic
982130427 4:152224280-152224302 TTAGAGAAGGCAAAAGGTGGAGG + Intergenic
982989593 4:162255174-162255196 TTAGCACAGGAGAAAGATGTAGG - Intergenic
986335986 5:6755749-6755771 TCAGAGCAGGACAACGGCCTGGG - Exonic
986802634 5:11278031-11278053 TTGGAGCAGGACAGAGGTGTTGG - Intronic
986981988 5:13458431-13458453 GTACAGCAGGACAAGGGTGATGG - Intergenic
988260425 5:28880382-28880404 TTAGGGCAGGACAAAAGTCATGG + Intergenic
988739707 5:34058344-34058366 GAAGAGCAGAGCAAAGGTGTGGG + Intronic
989252923 5:39335860-39335882 CTAGTGCAGGAGAAATGTGTGGG + Intronic
990182750 5:53180706-53180728 CTAGAGCAGGAGGAAGGGGTGGG - Intergenic
994856042 5:105120460-105120482 TAAGAGCAGGAGAAAGGGCTAGG + Intergenic
995083218 5:108078296-108078318 TTAGAGATGGACAAAGGAATGGG - Intronic
996642353 5:125771099-125771121 TTAGAGCAAGAGAATGATGTCGG - Intergenic
996929740 5:128871418-128871440 TGAAAGCAGGACAAAGGACTGGG - Intronic
998084575 5:139308086-139308108 TAAGAGATGGAGAAAGGTGTAGG + Exonic
998573182 5:143283853-143283875 TTAGAGCGAGACAAAGGATTTGG + Intronic
999500003 5:152137392-152137414 TTAGAGCAGCAGAAAGCTTTCGG + Intergenic
999910105 5:156188379-156188401 GTAGAGCAGGATAAAGGTAGTGG + Intronic
1004018512 6:11754692-11754714 TGAGACCAGGAACAAGGTGTGGG + Intronic
1006818532 6:36871217-36871239 ATAAAGCAGGAAAAGGGTGTGGG - Intronic
1006841875 6:37033686-37033708 TAAGGTGAGGACAAAGGTGTGGG - Intergenic
1008003439 6:46385008-46385030 TTAGTGCTGGACAAGGGTGATGG + Intronic
1008162313 6:48093451-48093473 TGCAAGCAGGACAAAGGTATTGG + Intergenic
1011107252 6:83796208-83796230 TAAGACCAGGACAGAGGTTTAGG - Intergenic
1011774631 6:90716098-90716120 TTGGAGCAGGGCAAGGGTGGAGG + Intergenic
1012085250 6:94817141-94817163 TGAGAGAAGGACAAGGGAGTTGG + Intergenic
1013853713 6:114545818-114545840 TTAGAGAAGAATAAAGGTGGAGG + Intergenic
1018673817 6:166201924-166201946 TGAGAGAAGGCCCAAGGTGTTGG - Intergenic
1018908536 6:168088923-168088945 TGAGAGCAGGCCCAAGGAGTGGG - Intergenic
1019127562 6:169851013-169851035 ATAGGGCAGGACACAGATGTCGG + Intergenic
1020750441 7:12134211-12134233 TATGAGCAGGAGAAAGGGGTTGG + Intergenic
1024955136 7:54910519-54910541 TAGGAGCAGGAAAAAGGGGTAGG + Intergenic
1026184645 7:68073061-68073083 TGAGAGCAAGGCAAAAGTGTAGG + Intergenic
1027308822 7:76931618-76931640 TTACAACAGGACCAAGGTCTAGG - Intergenic
1027393927 7:77733238-77733260 TGAGAGCAAGACAGATGTGTGGG + Intronic
1027831170 7:83179539-83179561 TTAGGCCAGGACAAAGGATTTGG + Intergenic
1028010334 7:85634975-85634997 TTACAGCTGGACAGAAGTGTTGG + Intergenic
1028581930 7:92417768-92417790 TTAGAGAAGGACAACTGTCTAGG + Intergenic
1031870692 7:127087218-127087240 TTAGAGCAACACCAAGCTGTGGG + Intronic
1031929480 7:127669801-127669823 TTAGAGAAGATCAAAGGTGTGGG + Intronic
1032695054 7:134328420-134328442 TTAGAGCGGGACAGTGGTGAAGG - Intergenic
1038104524 8:24417640-24417662 GCAGAGCAGGACACACGTGTAGG - Intergenic
1039345770 8:36703495-36703517 TTAGTACAGCACATAGGTGTAGG + Intergenic
1044071217 8:87762566-87762588 ATAAAGCAGGAAAAAGGTATTGG - Intergenic
1044642336 8:94396474-94396496 TTACAGGAGGATATAGGTGTAGG - Intronic
1044832079 8:96260858-96260880 TTAGAGCAGTACAAGGCTCTGGG - Intronic
1047241794 8:123096824-123096846 TTTGAGCAGGAAAAAAGTTTGGG + Intronic
1048461735 8:134626766-134626788 TTAGAGAAGGAAGAAAGTGTGGG - Intronic
1051694867 9:19757439-19757461 TTAAAGCAAGACAAAGGAGGAGG - Intronic
1052644325 9:31213549-31213571 TAAGATCAGGAAAAAGGTGAAGG - Intergenic
1053093432 9:35301787-35301809 TTAGAGGAGGACAAAGTTACAGG + Intronic
1053433700 9:38061017-38061039 TTTCCGCAGGACAAAGGTGGTGG - Intronic
1053605640 9:39655815-39655837 TTTAAGAAGGAAAAAGGTGTGGG + Intergenic
1053863559 9:42412445-42412467 TTTAAGAAGGAAAAAGGTGTGGG + Intergenic
1054247903 9:62686600-62686622 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1054562017 9:66721125-66721147 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1054927270 9:70601534-70601556 TCAGGGCAGGACACAGGGGTTGG + Intronic
1055008006 9:71530930-71530952 TTAGAGCAGGACAAAAAGCTTGG + Intergenic
1055154496 9:73043473-73043495 TTATACCAGGACAAGGGTTTTGG + Intronic
1055854521 9:80669912-80669934 CTACTGCAGGACCAAGGTGTGGG - Intergenic
1057164873 9:92917543-92917565 CTGGAGCAGGAACAAGGTGTAGG - Intergenic
1059269515 9:113063074-113063096 CTAGAGAAGGACAAAGGAGTGGG + Intergenic
1059270647 9:113068521-113068543 CTAGAGAAGGACAAAGGAGTGGG + Intergenic
1059271782 9:113073968-113073990 CTAGAGAAGGACAAAGGAGTGGG + Intergenic
1059272916 9:113079415-113079437 CTAGAGAAGGACAAAGGAGTGGG + Intergenic
1059274051 9:113084857-113084879 CTAGAGAAGGACAAAGGAGTGGG + Intergenic
1060491612 9:124089240-124089262 TCAGAGCAGGACAAAGGACACGG + Intergenic
1062067377 9:134536029-134536051 TTAGAACCGGACAGAGGTGGTGG - Intergenic
1186506377 X:10096335-10096357 ATAGAACAGAACAAAGGTGATGG - Intronic
1187562225 X:20413558-20413580 TCAGAGAAGTACAAAGGTGTGGG + Intergenic
1188365720 X:29312645-29312667 TTAGAACAGGAAAAAGTGGTTGG - Intronic
1188934279 X:36154076-36154098 TTAGGGGAGAACAAGGGTGTGGG - Intergenic
1188945538 X:36296706-36296728 GTAGACCAGGACAAATGTCTAGG + Intronic
1189379202 X:40489793-40489815 TTTGACCAGGACCAAGGTGAAGG + Intergenic
1190028469 X:46948301-46948323 TAATTCCAGGACAAAGGTGTAGG - Intronic
1192562043 X:72133581-72133603 TTACAGCGGGACTAAGGTGCAGG + Intergenic
1193247663 X:79248805-79248827 CTAGAACATGACAAAGATGTGGG + Intergenic
1197289486 X:124638038-124638060 TTAGATCTGGAAAAAAGTGTAGG - Intronic
1197674397 X:129313967-129313989 TGAGAGCAGGAGAAAGGTGGGGG + Intergenic
1197788658 X:130227414-130227436 CTAGAGAAAGACAAATGTGTGGG - Intronic
1202253066 Y:22893022-22893044 TGAGAGCAGGGAAAAGGTGTAGG + Intergenic
1202406056 Y:24526771-24526793 TGAGAGCAGGGAAAAGGTGTAGG + Intergenic
1202464724 Y:25143310-25143332 TGAGAGCAGGGAAAAGGTGTAGG - Intergenic