ID: 1169875398

View in Genome Browser
Species Human (GRCh38)
Location 20:10291786-10291808
Sequence ATGAAAATACAGATGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 886
Summary {0: 1, 1: 0, 2: 3, 3: 76, 4: 806}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169875397_1169875398 0 Left 1169875397 20:10291763-10291785 CCAGGAGGCACAGGCATGCATGC 0: 1
1: 0
2: 4
3: 23
4: 244
Right 1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG 0: 1
1: 0
2: 3
3: 76
4: 806
1169875396_1169875398 8 Left 1169875396 20:10291755-10291777 CCTTTATTCCAGGAGGCACAGGC 0: 1
1: 0
2: 0
3: 25
4: 380
Right 1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG 0: 1
1: 0
2: 3
3: 76
4: 806

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169875398 Original CRISPR ATGAAAATACAGATGAAAAG AGG Intronic
901004178 1:6163825-6163847 ATGAAGATACAGATGACAGTTGG + Intronic
902308357 1:15561097-15561119 AAAAAAAAAAAGATGAAAAGGGG - Intronic
903083628 1:20834555-20834577 ATGAAAATAGAAATCAAAAGAGG + Intronic
904142786 1:28367099-28367121 ATGAAAATAAAGATAAAACCGGG - Intergenic
904507122 1:30966509-30966531 AAGAGTATACAGATTAAAAGGGG + Intronic
904637650 1:31896133-31896155 ATGAACATAAAGATGAGAACAGG + Intergenic
904934701 1:34122024-34122046 CTGGAAAGAGAGATGAAAAGTGG - Intronic
905130822 1:35755705-35755727 CTAAAAAGACAAATGAAAAGTGG - Intronic
905977876 1:42192231-42192253 ATGGAAAGACAAAGGAAAAGAGG + Intronic
907237088 1:53059964-53059986 ATTAAAATAGAAATGACAAGTGG - Intergenic
907852069 1:58264895-58264917 AAGAAAATATAGATGACAATAGG - Intronic
908081596 1:60585540-60585562 ATGAAAATCAACATGAAAATAGG - Intergenic
908288499 1:62637017-62637039 ATGAATATTCAGAGGAAAACAGG + Intronic
908314116 1:62916091-62916113 AAGAAAATAGAGAAGAGAAGAGG - Intergenic
908553913 1:65237855-65237877 ATAAAAATATAGAAGAACAGAGG + Intergenic
908685171 1:66709625-66709647 GTGAGAATACAGAGGAAAAAGGG - Intronic
908912694 1:69091171-69091193 AGGCAAATAAAGAGGAAAAGGGG + Intergenic
909058164 1:70846720-70846742 ATTAATATAAAGATGAAATGAGG - Intergenic
910014960 1:82510685-82510707 ATGAAAATACATATTACAAAAGG + Intergenic
910057403 1:83049336-83049358 AATAAAATGCAGAAGAAAAGCGG + Intergenic
910097284 1:83538211-83538233 GTGTAGATACAGAAGAAAAGAGG + Intergenic
910097516 1:83540303-83540325 GTGTAGATACAGAAGAAAAGAGG - Intergenic
910132340 1:83923307-83923329 AAGAAAATAGAAATGAAAAGAGG + Intronic
910576419 1:88769954-88769976 ATAAACATACACATGAAAAGGGG + Intronic
911347063 1:96709827-96709849 ACTTAAATACAGATAAAAAGAGG + Intergenic
911350603 1:96749354-96749376 ATAATAATACATTTGAAAAGAGG + Intronic
911477947 1:98397026-98397048 ATGAAAATGAAGATGAAATGGGG + Intergenic
911959044 1:104275256-104275278 ATGTAAATAAAAATGCAAAGAGG - Intergenic
911994858 1:104753484-104753506 ATGATAATACATTTGAAATGTGG - Intergenic
912603115 1:110959298-110959320 ATGAAGAAACAGATTCAAAGAGG - Intronic
912998424 1:114554913-114554935 ATGAAAATACAGAGAAAGATGGG + Intergenic
913576598 1:120181447-120181469 ATGGAAAGACAAAGGAAAAGAGG - Intergenic
913597105 1:120388926-120388948 ATGACATTACAGATCAGAAGTGG - Intergenic
913677357 1:121153696-121153718 ATGCAAATACAAATTATAAGAGG + Intergenic
913941072 1:125106314-125106336 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
914029193 1:143941325-143941347 ATGCAAATACAAATTATAAGAGG + Intergenic
914090217 1:144490380-144490402 ATGACATTACAGATCAGAAGTGG + Intergenic
914160258 1:145126625-145126647 ATGCAAATACAAATTATAAGAGG - Intergenic
914308389 1:146443842-146443864 ATGACATTACAGATCAGAAGTGG - Intergenic
914322096 1:146575049-146575071 ATGAAAATGGAGCTTAAAAGAGG - Intergenic
914558508 1:148792882-148792904 ATGGAAAGACAAAGGAAAAGAGG - Intergenic
914593720 1:149129291-149129313 ATGACATTACAGATCAGAAGTGG + Intergenic
914614327 1:149337348-149337370 ATGGAAAGACAAAGGAAAAGAGG + Intergenic
915051050 1:153072513-153072535 ATGTAAATAGAGAAGAGAAGGGG + Intergenic
915102811 1:153512979-153513001 AGGAAAGTACAGAAGGAAAGGGG + Intergenic
915793483 1:158701320-158701342 AAGAATATACATATGAAGAGAGG - Intergenic
916316899 1:163459068-163459090 ATGAAAATAAAGAAGAAAAGAGG + Intergenic
916799416 1:168202317-168202339 ATGGAAATATTGATGAACAGAGG - Intergenic
916842068 1:168610713-168610735 ATGCAAAAACAGATGGCAAGTGG - Intergenic
917113235 1:171574406-171574428 AAGAAAATACAGCTGAAACCAGG + Intronic
917188781 1:172391235-172391257 ATGAAAGTACAGGGTAAAAGAGG + Intronic
917256550 1:173122363-173122385 ATAAAAAAAAAGAAGAAAAGAGG - Intergenic
917423944 1:174893961-174893983 ATGTAATTACAGAGGAAAAAAGG - Intronic
917721355 1:177789357-177789379 AGAAATAAACAGATGAAAAGGGG + Intergenic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
918610097 1:186479745-186479767 ATGAAGAAACAGATTAAGAGAGG + Intergenic
918635964 1:186774519-186774541 AGGAAAATACAGAGGAAAGCGGG - Intergenic
918761908 1:188420746-188420768 ATGAAAGTAAAAAAGAAAAGAGG - Intergenic
918873503 1:190008318-190008340 AAGAAAAAACAAAAGAAAAGAGG - Intergenic
918916617 1:190648577-190648599 ATTAAAATAGACATTAAAAGAGG - Intergenic
919074903 1:192801143-192801165 ATGTTAATACAGATAGAAAGTGG - Intergenic
919363706 1:196629512-196629534 ATTAAAATAAAAATGAAAAATGG + Intergenic
919674427 1:200367324-200367346 TTGGAAATACAGATTGAAAGAGG + Intergenic
920464660 1:206172212-206172234 ATGCAAATACAAATTATAAGAGG + Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920532108 1:206710457-206710479 ATGAAATTTCAAATGAAATGTGG + Intronic
920768183 1:208853564-208853586 AAGATAATGCAGCTGAAAAGTGG - Intergenic
921070815 1:211656208-211656230 ATGAAAATAAAGGTGAAATCTGG + Intergenic
921246982 1:213254570-213254592 ATAAAATTACAGATTATAAGAGG + Intronic
921411598 1:214841937-214841959 AAGAAACTACAGTTGAGAAGGGG - Intergenic
921628925 1:217410335-217410357 ATGAAAATGCAAATCAAAACAGG - Intergenic
921979353 1:221238662-221238684 ATGGAAATAAACATGAAAACAGG - Intergenic
922790949 1:228310722-228310744 ATGAAAAGATAGGTGAATAGTGG - Intronic
922863649 1:228840389-228840411 ATTAAAAAAAAGATGAAAAAAGG + Intergenic
923234189 1:232016336-232016358 AAGAAAATAAAAATGAAAAGTGG - Intronic
923397913 1:233585180-233585202 ATTAAAATAAAGATTAAAATGGG + Intergenic
923572865 1:235131744-235131766 AAGAAAGGACAGAAGAAAAGTGG - Exonic
1062852168 10:752934-752956 ATAATAAGAAAGATGAAAAGGGG + Intergenic
1063537413 10:6897914-6897936 ATGATAATCCAGTTAAAAAGTGG + Intergenic
1063839839 10:10058289-10058311 AAGAAAAAAAAGATGAAAGGAGG + Intergenic
1064435659 10:15308973-15308995 ATGGAAATACTGATTAAAATAGG - Intronic
1065048541 10:21766599-21766621 AAAAAAATAAAAATGAAAAGAGG - Intronic
1065270364 10:24025577-24025599 ATGAATCTACAGATGAATTGGGG + Intronic
1065505242 10:26423933-26423955 ATGGAAAGACAAAGGAAAAGAGG - Intergenic
1065684281 10:28268384-28268406 ATTAAAATTCAGATTTAAAGTGG - Intronic
1065783802 10:29194375-29194397 AAGAAAAGAAAAATGAAAAGAGG + Intergenic
1066015624 10:31240731-31240753 TTGAAAATACAGAGGCAAGGAGG + Intergenic
1068064133 10:52107332-52107354 ATTAAAATACAGCAGAACAGAGG - Intronic
1068291378 10:55005644-55005666 ATGAACTTACAGAAGAATAGAGG - Intronic
1070075656 10:73132489-73132511 CTGAAAATACTGATAGAAAGGGG + Intronic
1070189219 10:74096101-74096123 ATAAAAGTACAGATGATATGTGG - Intronic
1070764879 10:79050651-79050673 ATAAACATCCAGATGAAGAGAGG + Intergenic
1070937564 10:80313215-80313237 AGGAAAAGACTGATGAAAACAGG + Intergenic
1071064394 10:81613867-81613889 ATGATCACACAGAGGAAAAGTGG - Intergenic
1071396368 10:85227864-85227886 ATGGAAATACAGCTGAGAAATGG + Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1071674877 10:87646265-87646287 ATGATAAGACAAAGGAAAAGGGG + Intergenic
1072677588 10:97479861-97479883 AGGCAAATAGAGAGGAAAAGGGG + Intronic
1073417412 10:103396035-103396057 ATGGACATACAGAAGAAAAGAGG + Intronic
1073618385 10:105021722-105021744 ATGAGAAAACAGATGAAAGCTGG - Intronic
1073696180 10:105871094-105871116 ATGAAAAGACCAATGAATAGAGG - Intergenic
1073942046 10:108710757-108710779 ATGAAAATATATATGCAAATTGG + Intergenic
1073968145 10:109015017-109015039 AAGAAAATAAAGAGCAAAAGAGG - Intergenic
1074075210 10:110116930-110116952 ATTAAAATAAAGATGGAAGGTGG - Intronic
1074148281 10:110736476-110736498 AAGAAAATTCAGATGAAAACAGG - Intronic
1075583708 10:123642431-123642453 AAGAAACCACAGATGCAAAGAGG + Intergenic
1075825352 10:125352589-125352611 ATCAAAAGACAAATGAAAACAGG + Intergenic
1076410704 10:130247125-130247147 AGAAATGTACAGATGAAAAGAGG - Intergenic
1076434282 10:130429250-130429272 ATGAAAATAGACAGAAAAAGTGG - Intergenic
1077237938 11:1491332-1491354 ATGAAAATCAAGAAGAATAGAGG + Intronic
1077786402 11:5389193-5389215 ATTGAAATACAGAGGAAAACTGG + Intronic
1078074015 11:8140805-8140827 AAGAAAATACAGACTAACAGCGG + Intronic
1078097252 11:8307656-8307678 AAGAGAATACAGCTGGAAAGGGG - Intergenic
1079582492 11:22083360-22083382 TTGAAAATACAGAAAAAAACTGG + Intergenic
1079801280 11:24872544-24872566 ATGAAAACACACAGGAAGAGAGG - Intronic
1079852543 11:25555107-25555129 ATGAAAATACAGTTAGATAGTGG - Intergenic
1080255021 11:30281061-30281083 ATAAACATAGAGAAGAAAAGAGG + Intergenic
1082019011 11:47515499-47515521 ATCAAAATGCAGTTGGAAAGAGG - Intronic
1082205789 11:49432534-49432556 ATTAAAATACATATAAAAAAAGG + Intergenic
1083529163 11:63402212-63402234 TTAAAAACACAGAAGAAAAGAGG - Intronic
1085010539 11:73138151-73138173 ATGACAATACATATGAGATGTGG - Intronic
1085741449 11:79081179-79081201 CTGAGAAGACAGAGGAAAAGAGG - Intronic
1086246583 11:84760743-84760765 AGGAAAATACTGATTAGAAGAGG + Intronic
1086316374 11:85598433-85598455 TTGAAAATATAAATAAAAAGAGG - Intronic
1086641789 11:89167873-89167895 AAGAAAATAGAGAGGAAAAAAGG - Intergenic
1086649307 11:89267963-89267985 ATTAAAATACATATAAAAATAGG - Intronic
1086859172 11:91904697-91904719 ATGGAAATACATATGAAACAAGG - Intergenic
1087035542 11:93752549-93752571 AGGAAAATATGGAAGAAAAGAGG - Intronic
1087373356 11:97313710-97313732 ATTAAACTACAGATTAAAAAGGG + Intergenic
1087882706 11:103437361-103437383 ATGAAAAGACAGAAGAACAAGGG - Intronic
1087934405 11:104015800-104015822 ATGAAAATAGAAATGGAAAATGG - Intronic
1087951613 11:104227566-104227588 AAGAAAATAATGATGAAAAGAGG - Intergenic
1088548867 11:110990012-110990034 ATGAAAATCCAAATGAAAGCAGG + Intergenic
1088970125 11:114766621-114766643 AGGAAAAAAAAGAGGAAAAGAGG - Intergenic
1089088344 11:115843407-115843429 TTGAAAATAAAGATGTGAAGTGG - Intergenic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1090289505 11:125529671-125529693 ATGAATAGAGAGATGAAATGTGG - Intergenic
1090367194 11:126216464-126216486 CTGTAAAGACAGAGGAAAAGAGG - Intronic
1090478578 11:127047345-127047367 TTGAATATACTTATGAAAAGGGG - Intergenic
1090754839 11:129781016-129781038 ATAAAAATAAAAATGAAAATTGG - Intergenic
1090872562 11:130761329-130761351 ATGAAAATAAAGAGCAGAAGTGG + Intergenic
1091087730 11:132739189-132739211 GTGACAAGACAGAGGAAAAGAGG - Intronic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1093232333 12:16562041-16562063 ATCAAAATACAGATTACAAAAGG - Intronic
1093381921 12:18503356-18503378 AAGAAAATACAATTAAAAAGTGG + Exonic
1093508611 12:19899802-19899824 AAGATAATACAGAAGAAAAATGG - Intergenic
1094049839 12:26206907-26206929 ATGAAAATACAGAGGGAGAGTGG - Intronic
1094860011 12:34453763-34453785 AGGAAAATACAGATAAATACTGG - Intergenic
1095109679 12:38279282-38279304 ATGAACACACAGATGAAAGGTGG - Intergenic
1095262728 12:40116033-40116055 AAGAAAATAAAGAGGAAAAGGGG + Intergenic
1095328560 12:40928546-40928568 AACAGAATACAGATAAAAAGAGG - Intronic
1095478746 12:42611806-42611828 ATGAAGATACAGAGGGGAAGAGG + Intergenic
1095722607 12:45417050-45417072 ATGAAAATACATTTAACAAGTGG - Intronic
1095790917 12:46166084-46166106 ATCAAAATGTAGATGAAAAAGGG + Intergenic
1096043272 12:48539505-48539527 ATGAAAAGAGAAATGAGAAGTGG + Intergenic
1096422578 12:51472555-51472577 AAGAAAATAATGATAAAAAGAGG - Intronic
1096446574 12:51698238-51698260 ATGAAAAAACAGATTCTAAGAGG + Intronic
1097422639 12:59399279-59399301 AGAAAAATACAGATGAACATAGG - Intergenic
1098595039 12:72263118-72263140 ATAAAAATAAAAATGAGAAGAGG + Intronic
1098794627 12:74873682-74873704 TTGAGCAAACAGATGAAAAGTGG + Intergenic
1099191260 12:79564254-79564276 AAGATAATACAGATTTAAAGAGG - Intergenic
1099405821 12:82260896-82260918 ATGAAATTACAGATTAATAGCGG - Intronic
1099670508 12:85685942-85685964 ATTAAAAAATAAATGAAAAGGGG + Intergenic
1100369588 12:93955494-93955516 ATGAATACAAAGATGAGAAGTGG + Intergenic
1100541194 12:95559125-95559147 TTGATAATACAGAAGAAAAAAGG - Intergenic
1100574881 12:95881722-95881744 ATGAATATACAAAAGAAAATTGG + Intronic
1100756706 12:97759115-97759137 ATGAAAATCCAGGTGATAAAGGG - Intergenic
1101059891 12:100959820-100959842 ATGGAGATACAGAAGAAAAGGGG - Intronic
1101851842 12:108409571-108409593 CTGTTAATACTGATGAAAAGGGG - Intergenic
1102663890 12:114553653-114553675 ATGAAAATAAATAAGTAAAGTGG - Intergenic
1103317745 12:120070681-120070703 ATCAAGATACAGATTAAAATGGG + Intronic
1103496426 12:121366092-121366114 AAGAAAATCCAGCTGAAAGGGGG + Intronic
1103729248 12:123015636-123015658 ATGATAAAACAGAAGAAAACTGG + Intronic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1105320929 13:19321220-19321242 ATAAAAATGCAGAAAAAAAGAGG - Intergenic
1105519833 13:21122318-21122340 AAGAAAATGCATAGGAAAAGTGG - Intergenic
1105627337 13:22125568-22125590 ATGGAAAAACAGAAGAAAACAGG + Intergenic
1105639856 13:22251319-22251341 ATACCAATACAGATAAAAAGAGG - Intergenic
1105675788 13:22670507-22670529 ATGACATTACAGATGTAATGAGG + Intergenic
1105955319 13:25276601-25276623 AATAAAATCCAAATGAAAAGCGG - Intronic
1106044767 13:26128723-26128745 ATGAAAATTATGATTAAAAGTGG + Intergenic
1106062507 13:26308450-26308472 ATGAGAAAACTGATGTAAAGAGG - Intronic
1106365802 13:29079579-29079601 TTTAAAATATAGATGAATAGGGG + Intronic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107162658 13:37250052-37250074 ATAAAAAGACAGATGATAATGGG - Intergenic
1107203145 13:37747015-37747037 AGAAAAGCACAGATGAAAAGAGG - Intronic
1107535338 13:41323901-41323923 ATGAAATGACAGATAAACAGAGG - Intronic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1107734289 13:43380734-43380756 ATGAAAAGAAAGCTGGAAAGGGG + Intronic
1107915461 13:45145537-45145559 ATAGAAATACAGATGTAAAGAGG - Intronic
1108398751 13:50017156-50017178 ATGAAAATAAAGTTGTACAGAGG - Intronic
1108399469 13:50024599-50024621 ATGAAAATATAGATGTATATGGG + Intergenic
1108462417 13:50679608-50679630 AGGAAAATACTGATGCAATGTGG - Intronic
1109323297 13:60836334-60836356 AGGAAAACACCAATGAAAAGAGG - Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109752760 13:66718015-66718037 ATTAAAAAACAGTTGAAAAAGGG + Intronic
1109864836 13:68249390-68249412 TTTAAAATAAAAATGAAAAGGGG + Intergenic
1110173535 13:72530816-72530838 AAGAAAAGACAGCTGCAAAGAGG + Intergenic
1110182228 13:72631303-72631325 AAGTAAAAAAAGATGAAAAGTGG + Intergenic
1110948085 13:81449753-81449775 GTGAAAATTCAGATGTAAAAAGG + Intergenic
1111250248 13:85592132-85592154 ATGAATATACAGAAAAAAACTGG - Intergenic
1111319175 13:86602861-86602883 ATGATAAAACACATAAAAAGAGG - Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1112139599 13:96623774-96623796 ATGGAAATCCAAATGGAAAGTGG + Intronic
1112347738 13:98604978-98605000 GTGAAAATACAGAAGAAAATGGG + Intergenic
1112489475 13:99848757-99848779 GTGAAAACACAGAGTAAAAGTGG + Intronic
1112683558 13:101795918-101795940 CTGAAAATACAGCTGAATTGAGG + Intronic
1113059328 13:106304737-106304759 ATGAAGACACAGGTTAAAAGTGG + Intergenic
1113166602 13:107450177-107450199 ATGAAAACACAGGGGAAGAGTGG + Intronic
1114638545 14:24203287-24203309 ATGAGAAGACAGATGAAGTGTGG - Intronic
1114641458 14:24224831-24224853 CAGGAAATACAGAGGAAAAGAGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114976505 14:28107222-28107244 ATGAAAATATAGTAGAAAAATGG - Intergenic
1115081639 14:29459853-29459875 ATGAAAACCCAGATGATCAGAGG + Intergenic
1115978906 14:39028334-39028356 ATGAAAATAAAAATGTAAAATGG + Intergenic
1116393474 14:44421007-44421029 ATGAAATTTGAGATAAAAAGAGG + Intergenic
1116686199 14:48041840-48041862 ATGAAAATCAAGCTGAAAATAGG + Intergenic
1116890434 14:50262648-50262670 ATGAAAATAAAAATGAGCAGGGG - Intronic
1117619722 14:57572943-57572965 TTTAAAATCCAGATGAAAATTGG + Intronic
1118093488 14:62509754-62509776 ATTAAAACACATAGGAAAAGTGG + Intergenic
1118978333 14:70696277-70696299 ATGAAAATACTGATGAATACTGG + Intergenic
1119060530 14:71469676-71469698 ATGAGAATATGGATGAAAGGGGG - Intronic
1119124848 14:72116232-72116254 ATGAAACCCCAGAAGAAAAGAGG + Intronic
1119816891 14:77577556-77577578 GTGAATATACACATGAGAAGGGG + Intronic
1120050128 14:79856398-79856420 CTGAAAATTCACATGATAAGGGG - Intronic
1120267136 14:82265543-82265565 AAGAAGATACAGATTAAAATTGG + Intergenic
1120401914 14:84043042-84043064 CTGAAAATGCAGATGGCAAGTGG - Intergenic
1121037045 14:90714888-90714910 GAGAAAATAGAGATGAAAATTGG - Intronic
1121149819 14:91622388-91622410 ATGAAGATTTAGAAGAAAAGAGG + Intronic
1121876757 14:97459709-97459731 TTTAAAATACCCATGAAAAGGGG - Intergenic
1123771023 15:23529287-23529309 ATGAAAATCCTGCTCAAAAGAGG + Intergenic
1123817496 15:23994660-23994682 AAGCAAATACAGTGGAAAAGGGG - Intergenic
1125101812 15:35922391-35922413 ATGAGCAGACAGATGAAGAGAGG - Intergenic
1125641503 15:41234351-41234373 AAGAAAAGGCAGATGAAAATGGG - Intronic
1126157477 15:45578684-45578706 ATGTAAATACAAGTGAAAAGTGG + Intergenic
1126384216 15:48077130-48077152 ATGAAAGAAAAGAGGAAAAGAGG + Intergenic
1126417279 15:48430895-48430917 GTGAAATAACAGATGAAAATTGG - Intronic
1126504849 15:49393008-49393030 ATGAAAATCATGAAGAAAAGAGG + Intronic
1126578710 15:50222451-50222473 ATGACAATAAAGAAGAAAACAGG - Intronic
1126718028 15:51542969-51542991 ATGAAAATACAGAATAACAAGGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127120839 15:55770800-55770822 AAGGAAATACAGAGGTAAAGAGG - Intergenic
1127577148 15:60302877-60302899 ATGAAAATACAATAGAAATGAGG - Intergenic
1127686817 15:61354009-61354031 ATGAAGTTACAGATGGGAAGAGG + Intergenic
1128173047 15:65530056-65530078 AAGTAATTACAGATGAAATGAGG - Intergenic
1131320899 15:91389913-91389935 ATAAAATTAAAGGTGAAAAGGGG - Intergenic
1131696220 15:94880762-94880784 AAGAAAAGACAGAAGAAAAAAGG - Intergenic
1131946861 15:97631607-97631629 ATGAAAATCTAAATGAAATGAGG + Intergenic
1132029325 15:98427527-98427549 AAAAAACTACAGATGAAAATGGG + Intergenic
1132123938 15:99203570-99203592 ATAAAAATACAGGTGAATAATGG - Intronic
1132244375 15:100283000-100283022 TGGAAAATACAGAGGAAAATAGG - Intronic
1132315154 15:100884674-100884696 ATGAAAATACACATTTTAAGGGG + Intronic
1133399427 16:5473865-5473887 ATGGAAAGACAGATGTAAGGGGG + Intergenic
1134198814 16:12180926-12180948 AAGAAGATCCAGATGAAATGGGG - Intronic
1134654430 16:15937307-15937329 ATGAAAATAAAAATAAAAAAGGG - Intergenic
1134659264 16:15971501-15971523 AGGCAAATAGAGAGGAAAAGGGG - Intronic
1135231989 16:20717008-20717030 ATGAAAATACACAGGTAAGGTGG + Intronic
1136416359 16:30106536-30106558 TTAAAAATACAGATGAGACGAGG + Intronic
1136670032 16:31848549-31848571 ATGGAAAGACAAAGGAAAAGAGG - Intergenic
1136670488 16:31852335-31852357 ATGGAAAGATAAATGAAAAGAGG - Intergenic
1137085314 16:36113692-36113714 ATGAAAAGACAAAGGAAAGGAGG - Intergenic
1137516777 16:49151744-49151766 ATGAAATTACAAATGAAAAAAGG + Intergenic
1137640909 16:50027871-50027893 ATGGAAATACATAGGAAATGTGG + Intronic
1137778124 16:51073516-51073538 ATTAAATTAAATATGAAAAGTGG - Intergenic
1137938009 16:52653703-52653725 AGGAAAATGCAAATCAAAAGTGG - Intergenic
1138083538 16:54114236-54114258 ATGAAAAAACGGAGAAAAAGAGG - Exonic
1138364100 16:56458518-56458540 ATGAAAATAGAGAAAAAAAAGGG - Intronic
1138366790 16:56485833-56485855 ATGAAAATATAGCTTAAAAATGG - Intronic
1139076863 16:63461871-63461893 ATGGAAAGAGAGGTGAAAAGGGG + Intergenic
1139241775 16:65399630-65399652 ATGAAAATACAGAAGTTAAAAGG - Intergenic
1140011531 16:71136116-71136138 ATGAAAATGGAGCTTAAAAGAGG + Intronic
1140160215 16:72482576-72482598 AGTGAAATACAGATAAAAAGAGG - Intergenic
1140579644 16:76214603-76214625 ATGTAAGTACAGATGAAAATGGG - Intergenic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1141209712 16:81965832-81965854 TTGAAAATAAAAATGAAAAAAGG - Intergenic
1141832781 16:86519008-86519030 ATGAAATGACAGATGGACAGAGG + Intergenic
1142463777 17:115347-115369 ATGAAAAGCCAGATGAAGAGAGG + Intergenic
1143073198 17:4315774-4315796 ACAAAAAAACAGAAGAAAAGAGG + Intronic
1143488815 17:7271634-7271656 AGGAAAAAATAGGTGAAAAGAGG + Intergenic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1144435887 17:15240337-15240359 AAGAAAATACTGATGAAGAAAGG + Intronic
1145245707 17:21268080-21268102 ATAAAAATTCAGAGGAAAGGGGG + Intergenic
1146095114 17:29922646-29922668 ATTAAAATAAAAATGAAATGAGG + Intronic
1147357520 17:39909547-39909569 AAGAAAATGCAAATGAAAAGAGG + Intronic
1147358041 17:39912749-39912771 ATGAAGAAACAGATTCAAAGAGG - Intronic
1147698845 17:42378595-42378617 CTAAACATACTGATGAAAAGAGG + Intronic
1148883765 17:50756140-50756162 ATAAACATACAGATTAAAAAAGG - Exonic
1149462560 17:56842737-56842759 ATGAATATAAAAAAGAAAAGAGG - Intronic
1149619277 17:58030017-58030039 AAAAAAAGACAAATGAAAAGGGG + Intergenic
1149736433 17:58998587-58998609 ATGAAAATAAAGAAGAAAAGGGG + Exonic
1149952898 17:61010226-61010248 ATAAAAACACAGAAGAAAAATGG - Intronic
1151140444 17:71986405-71986427 ATCAAAGTACAGATGGAGAGTGG - Intergenic
1152273780 17:79341914-79341936 ATGTGAAAAGAGATGAAAAGTGG + Intronic
1203182561 17_KI270729v1_random:76138-76160 ATGAAAAGACAAACGAAAGGAGG + Intergenic
1203190504 17_KI270729v1_random:181635-181657 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1153208049 18:2725056-2725078 ATGAAATTGTAAATGAAAAGTGG + Intronic
1153370174 18:4306486-4306508 AAGAAAATAAAGAAGAAAGGAGG + Intronic
1154276993 18:12970398-12970420 AAGAAAAAACAGATGGACAGGGG - Intronic
1155034270 18:22011492-22011514 GAGAAAAGACAGAGGAAAAGAGG - Intergenic
1155079857 18:22398046-22398068 CTGAAAATACAGAAGTGAAGTGG + Intergenic
1155080486 18:22405423-22405445 TTAAAAATAAAGAGGAAAAGGGG + Intergenic
1155642210 18:28031680-28031702 AGGAAAGAACAGAGGAAAAGGGG + Intronic
1155790518 18:29963004-29963026 GTTAAAATACAGAAAAAAAGAGG + Intergenic
1155951980 18:31923699-31923721 ATAAAAATAAAGCTGAAAGGAGG + Intronic
1156178358 18:34574149-34574171 ATCAAGCTCCAGATGAAAAGGGG - Intronic
1156218055 18:35021828-35021850 ATAAAGATTCAGATTAAAAGAGG + Intronic
1156759881 18:40575650-40575672 CTGAAAATATAGTTGAAAGGTGG + Intergenic
1156846884 18:41676325-41676347 ATGACAAATCAGATGAAAAGAGG + Intergenic
1156887707 18:42154773-42154795 ATGAAAAGAATGATGACAAGTGG - Intergenic
1157001796 18:43536208-43536230 ATCAAAATAAAGATGCATAGTGG + Intergenic
1157227271 18:45878529-45878551 ATGAAGCTACAGATAATAAGAGG - Intronic
1157601926 18:48898196-48898218 AAAAAAAAAAAGATGAAAAGGGG + Intergenic
1157652736 18:49351386-49351408 ATAAAAATACATTTAAAAAGAGG + Intronic
1157897835 18:51485396-51485418 ATGAACATAAAGATGAACGGGGG - Intergenic
1157910548 18:51613986-51614008 ATGCAAATACAGAGGCACAGAGG - Intergenic
1158129490 18:54137048-54137070 GTGAAGAAACAGATGAGAAGGGG - Intergenic
1158313707 18:56187539-56187561 AAGGAGATATAGATGAAAAGAGG + Intergenic
1158333780 18:56392303-56392325 ATGAAATTTCAGAGGAAAAAAGG - Intergenic
1158619187 18:59016128-59016150 ATGAAAACACAGATCAAGAAGGG + Intergenic
1158716669 18:59886537-59886559 ATGGAAAGACAAAGGAAAAGAGG + Intergenic
1158928581 18:62297419-62297441 ATGAAAATATAGAAGAAAGAAGG + Intronic
1159237160 18:65691604-65691626 AGGAGAAGAGAGATGAAAAGTGG - Intergenic
1159514110 18:69435361-69435383 ATGTAAATACAGATAAAATATGG + Intronic
1159553266 18:69918825-69918847 TGGAAAATACAGATGGAAAGTGG + Intronic
1159687430 18:71440236-71440258 TTGAAAATAAAGATTAAAATTGG + Intergenic
1159974597 18:74694844-74694866 ATGAAAATACAGACTGAAATAGG - Intronic
1161256143 19:3310847-3310869 ATGGAAAGAGAGATGGAAAGAGG - Intergenic
1163172510 19:15542186-15542208 AAGAAAAGAAAGATGTAAAGAGG - Intronic
1163705321 19:18809030-18809052 AAGAAAATAGAAAAGAAAAGAGG + Intergenic
1163809095 19:19419245-19419267 ATGAAAATGAAGATGAGAATTGG + Intronic
1165006484 19:32811885-32811907 ATCAAAAAACAGAAAAAAAGTGG + Intronic
1165009847 19:32836901-32836923 ATGAATATACAGAAAAACAGGGG - Intronic
1165678450 19:37749516-37749538 ATGTAAATACATATGAGAAAAGG + Intronic
1165737599 19:38186653-38186675 AACTAAATACATATGAAAAGGGG - Intronic
1165845200 19:38813465-38813487 ATGATCATACAGCTGAGAAGTGG - Intergenic
1167222431 19:48209729-48209751 ATGAAAATTTTGATGAATAGTGG - Exonic
1167556100 19:50196650-50196672 ATAAACATACAGATGGACAGAGG - Intronic
1202668744 1_KI270709v1_random:28039-28061 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
925219281 2:2124718-2124740 ATGCAGAGACAGATGTAAAGAGG + Intronic
925240718 2:2324466-2324488 ATTAGCATACAGATGAGAAGTGG - Intronic
925787258 2:7444515-7444537 CTTAAAATTCAGATGAAAAGTGG - Intergenic
925827684 2:7865631-7865653 TTAAAAATATAGGTGAAAAGAGG + Intergenic
926024449 2:9528981-9529003 ATGTAAATATAGCTAAAAAGTGG + Intronic
927058789 2:19393188-19393210 ATAAAAATACAAATAAAAGGAGG - Intergenic
927468897 2:23357452-23357474 TTTAAAATAAAGATGAATAGTGG - Intergenic
927661897 2:25000589-25000611 AGGAAAACAAAGATGAAGAGGGG - Intergenic
928250030 2:29668135-29668157 ATGAAATTAGAAATGAAGAGGGG - Intronic
928320413 2:30278814-30278836 TTGAAGATACAGAAGAAAGGAGG - Intronic
928536371 2:32245325-32245347 AAAAAAAAACAGATGAATAGAGG + Intronic
928674619 2:33638477-33638499 AAGAAATTACAGATAATAAGAGG - Intergenic
928720303 2:34113597-34113619 AAGAAAATTCAGATGAAAGTGGG - Intergenic
928862043 2:35870598-35870620 CTAAAAATACATATCAAAAGAGG + Intergenic
929454959 2:42058974-42058996 ATGAACATTCAGAAGAAAGGAGG + Intergenic
930323180 2:49881200-49881222 ATGCAAATACAAAGGAAAACTGG - Intergenic
930331410 2:49989846-49989868 ATTAAAAAACAGATAAAAATTGG - Intronic
930710585 2:54547736-54547758 ATAAAAATAGTAATGAAAAGAGG + Intronic
930829134 2:55724667-55724689 AGGAAAACTCAGAAGAAAAGAGG - Intergenic
930998153 2:57747853-57747875 TTGATAATACAGATGAATAATGG - Intergenic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
931494500 2:62787684-62787706 ATGAAAGAATAGATGAAAAAAGG + Intronic
931573369 2:63694075-63694097 GTGAAAATACAGTAGAGAAGAGG - Intronic
931950396 2:67355836-67355858 ATAAAAATGAAGAAGAAAAGAGG + Intergenic
932261781 2:70333060-70333082 TTGAAAATTCAGATGAGAAGAGG - Intergenic
932578606 2:72978036-72978058 AAGAAAATATAGATGAACACTGG - Intronic
933061022 2:77736489-77736511 TTGAACATACAGAAGAAAATAGG - Intergenic
933262183 2:80142935-80142957 TGGAAAAGAGAGATGAAAAGGGG + Intronic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
934021101 2:87953500-87953522 ATAAATGCACAGATGAAAAGAGG - Intergenic
934023242 2:87976349-87976371 ATGAAAAAAATCATGAAAAGGGG + Intergenic
936413315 2:112280056-112280078 ATGAAAAAAATAATGAAAAGGGG - Intronic
936654481 2:114468962-114468984 AGGAAAAGACAAATGAAAATGGG + Intronic
936780290 2:116024691-116024713 ATGAAAATACTTAAGAAAAGGGG + Intergenic
936980910 2:118264353-118264375 AGGAAAATATACATGCAAAGAGG - Intergenic
937070772 2:119061359-119061381 AGGAAAAGAAAGATGAAAAGGGG - Intergenic
937438705 2:121899539-121899561 ATGAAAATGGTGATGAAAAAAGG + Intergenic
937563295 2:123251770-123251792 ATGAAAATGAAAATGAAATGAGG + Intergenic
937588030 2:123580032-123580054 ATGAGAATGAAGAAGAAAAGAGG + Intergenic
937788112 2:125926070-125926092 ATGAAAATTCAGAAGACCAGGGG - Intergenic
938605183 2:132884796-132884818 ATGGAAATAAAGCTGAAAATGGG + Intronic
938621164 2:133054905-133054927 ATGAAAACCCTGATGAAAAGTGG + Intronic
938819078 2:134936140-134936162 AAAAAAAAAAAGATGAAAAGCGG - Intronic
939589860 2:144051641-144051663 TTAAAAATACACATAAAAAGAGG + Intronic
939619350 2:144399263-144399285 CAGAAAGTACAGATGACAAGAGG + Exonic
939737751 2:145870027-145870049 AGGAGAATTCAGATGAAAAAAGG - Intergenic
939845906 2:147245812-147245834 ATGAAAGTACAGGTGAATTGGGG + Intergenic
940242372 2:151577277-151577299 ATGGAAGTACAGATGACACGAGG - Intronic
940284436 2:152019661-152019683 ATGGAAATAAAGGTTAAAAGAGG + Intronic
940591737 2:155737553-155737575 CTGAGAATTCAGATGAATAGAGG - Intergenic
941409937 2:165142340-165142362 ATGAAAATAAAGCTAAAAATTGG - Intronic
941508787 2:166379815-166379837 ATGAAACAACTGAAGAAAAGAGG + Intergenic
941515519 2:166471111-166471133 ATGAGAATAAAGATGAAGAGAGG + Intronic
942535801 2:176962172-176962194 ATGAAAACAAAGTTAAAAAGAGG - Intergenic
942794645 2:179803735-179803757 AAGATAATTCAGATGTAAAGAGG + Intronic
943503320 2:188719903-188719925 ATGATAAAACAGATGGGAAGTGG + Intergenic
943532813 2:189107346-189107368 ATGAAGATACAGTTGAATAAAGG + Intronic
943639499 2:190343456-190343478 ATGAGAGTACAGATGAATGGAGG + Exonic
943802499 2:192079304-192079326 ATGAAAAGAAAGAGGAAAGGAGG - Intronic
943936945 2:193931433-193931455 ATGAAAATATAGATGAATAAGGG + Intergenic
944651928 2:201838849-201838871 ATGAGAATACTGATGAAAAAAGG - Intronic
945004063 2:205384335-205384357 ATGGAAAGACAGAGAAAAAGGGG + Intronic
945179617 2:207078411-207078433 ATGAGACCACAGATGAAAATAGG + Exonic
945458024 2:210071250-210071272 AAAAAAATAAAAATGAAAAGGGG - Intronic
945619291 2:212113107-212113129 ATGAAAATACAGATCGAATTTGG + Intronic
945732405 2:213555052-213555074 ATCAAAAAACAAATAAAAAGAGG + Intronic
945861142 2:215123757-215123779 ATTAAAATAAAGATTAAAAAAGG - Intronic
946564082 2:220943770-220943792 ATGACAATAGAGAGGAAAATTGG + Intergenic
947292107 2:228587146-228587168 ATGAAAATGGAGATGAAATATGG - Intergenic
947373579 2:229473075-229473097 AACAAAATGGAGATGAAAAGGGG + Intronic
947419612 2:229930394-229930416 ACAAAAAGACAGCTGAAAAGAGG - Intronic
947787955 2:232841609-232841631 ATGAAAATACAAATGAAGGCAGG - Intronic
947965387 2:234276383-234276405 AACAAAAAACAGAGGAAAAGTGG - Intergenic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1170056576 20:12211524-12211546 ATGAAAACACAGATGCACACTGG + Intergenic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170620097 20:17988746-17988768 ATAAAAATAGAGATTAAAAAAGG - Intronic
1170701419 20:18707088-18707110 ATGAACATCCAGGTGAAAAGTGG - Intronic
1170870813 20:20204469-20204491 AAGAACAGCCAGATGAAAAGGGG - Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1173050197 20:39551952-39551974 ATAAATATACTGATGAAAAGGGG - Intergenic
1173240379 20:41290642-41290664 ATGAGAAAACAGATGCAGAGAGG + Intronic
1173266734 20:41490501-41490523 AGCAAAATATAGATTAAAAGTGG + Intronic
1173936016 20:46865343-46865365 ATGAAAATATACATGTAAAATGG - Intergenic
1174735883 20:52965348-52965370 AAGAAAATACAGAGAAAGAGTGG + Intergenic
1174891708 20:54402329-54402351 ATGTCATTCCAGATGAAAAGTGG - Intergenic
1174939123 20:54904754-54904776 ATAAAACTACACATAAAAAGAGG + Intergenic
1175707818 20:61193882-61193904 ATGAAAAGACAAAGGAAAAGAGG + Intergenic
1176997558 21:15574438-15574460 ATGAAAAAAAAAATAAAAAGAGG + Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177390671 21:20466066-20466088 ATGAAAAGACAAAAGAAATGTGG - Intergenic
1177411585 21:20737053-20737075 ATGTAATTACAGAAGCAAAGGGG - Intergenic
1177411588 21:20737090-20737112 ATGTAATTACAGAAGCAAAGGGG - Intergenic
1177497773 21:21911075-21911097 AGGGAAATACAGAGTAAAAGAGG - Intergenic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1178044133 21:28675274-28675296 ATGATAATAAAAATGAAAAATGG + Intergenic
1178203017 21:30429902-30429924 ATGTGAATACACAGGAAAAGAGG + Intergenic
1178242288 21:30916644-30916666 ATGAAAATTTTGATGAATAGTGG - Intergenic
1178503327 21:33143670-33143692 AAGAAAATAAAGATTACAAGAGG - Intergenic
1178565848 21:33683802-33683824 ATCAAAATGCAAATGAAAACTGG - Intronic
1178609228 21:34066526-34066548 AAGAAAATACAAATTAAAACTGG - Intergenic
1178727649 21:35068915-35068937 ATGAGAATGAAGATGAAAAAGGG - Intronic
1178997767 21:37420908-37420930 ATAAAAATACAAATGACAAAAGG - Intronic
1179268715 21:39831045-39831067 ATCAAAATAGAGATGTCAAGGGG - Intergenic
1179599935 21:42470669-42470691 ATAAAATTACAAATGAAAAGTGG - Intergenic
1179652909 21:42825115-42825137 ATAAAATTATAGATGAAAAAGGG + Intergenic
1179977613 21:44878245-44878267 ATGGAAAGACAAAGGAAAAGAGG + Intergenic
1180041554 21:45282959-45282981 ATGAAAAGACACAGGGAAAGAGG + Intronic
1181276807 22:21692531-21692553 ATGAAAATAAATATAAAAAATGG - Intronic
1182085063 22:27555785-27555807 AGGAAGATAAAGCTGAAAAGGGG + Intergenic
1182232200 22:28846968-28846990 ATGGAAAGACAAAGGAAAAGAGG - Intergenic
1182858126 22:33535819-33535841 GTGAAAATACAGATGGGACGGGG - Intronic
1183738318 22:39656115-39656137 ATGTAATTACAGATGGAAATGGG + Intronic
1184081556 22:42224953-42224975 ATGTAAATAGAAATGAAAAGGGG - Intronic
1184275803 22:43409049-43409071 ATGAAAAAATAGAGGGAAAGAGG - Intergenic
1184765794 22:46571616-46571638 ATGGAAAGACAAAGGAAAAGAGG - Intergenic
949128626 3:475085-475107 ATAAAAATGCAGATTAAAATGGG - Intergenic
949142323 3:649781-649803 TTGAAAATGGAGATGAACAGTGG - Intergenic
949707637 3:6837250-6837272 ATGAAAACACAAATAAAAAAAGG + Intronic
949858846 3:8487153-8487175 ATAACAGTACAGATGATAAGAGG + Intergenic
950346553 3:12299594-12299616 TTGAAAATCCAAATGACAAGAGG + Intronic
950951491 3:17004591-17004613 ATGAGAAAAAAGAAGAAAAGGGG - Intronic
951617086 3:24559063-24559085 ATGAAACTTGTGATGAAAAGAGG + Intergenic
951997076 3:28743113-28743135 GTGAAAACAGAGATGCAAAGTGG + Intergenic
952103827 3:30046451-30046473 ATAAAAAGAAAAATGAAAAGAGG + Intergenic
952457750 3:33489917-33489939 ATGAAAACAAAGTTGAAAAGTGG + Intergenic
952557056 3:34544100-34544122 ATGAAGATAGAGATGAAGATTGG - Intergenic
953327629 3:42026068-42026090 ATGAGAATACAGAAAAATAGAGG - Intronic
953874014 3:46654383-46654405 AGGAGAATACAGATGGCAAGGGG + Intergenic
954499419 3:50996681-50996703 ATGAAAAAAGAGAAGAAAAGAGG + Intronic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
956232644 3:67034245-67034267 ATAAAAATAAAAATAAAAAGAGG - Intergenic
956237283 3:67087741-67087763 ATGCAAATACATATCAAAAAAGG + Intergenic
957275990 3:78092504-78092526 ATGAAAAGACACCTGAAATGTGG + Intergenic
957355308 3:79075873-79075895 ATTATAATAAAAATGAAAAGGGG + Intronic
957887842 3:86313517-86313539 ATGAAAGAACACATGAAAAGAGG - Intergenic
957896708 3:86430023-86430045 AGGAAAATACATATATAAAGGGG - Intergenic
957901219 3:86494803-86494825 AGGAGAATACAGAAGAAAAAAGG + Intergenic
958203267 3:90350749-90350771 ATGAAAGCACACATCAAAAGGGG + Intergenic
958261342 3:91384751-91384773 CTAAAAATACAGAGGAAAACAGG + Intergenic
958972620 3:100629125-100629147 TTGAAAAACCAGATGAAAATGGG - Intronic
958984437 3:100763915-100763937 ATGAAAACACAAATGAAAAGTGG + Intronic
959142998 3:102508383-102508405 ATGAAAATACAATTGAAAATTGG - Intergenic
959231349 3:103656297-103656319 AAGAAAAAACAGATGTACAGAGG + Intergenic
959847077 3:111045795-111045817 AAGAAAATAAAGATGAGATGAGG - Intergenic
959968615 3:112383209-112383231 ATTAAATTTCAGAAGAAAAGTGG + Intergenic
960290020 3:115872626-115872648 ATAAAAATACAGAAACAAAGAGG + Intronic
960442800 3:117710079-117710101 ATGAAAGTAGACAGGAAAAGCGG - Intergenic
960478628 3:118161114-118161136 ATGAATAAACAGATAAAATGTGG + Intergenic
961438797 3:126938350-126938372 CTGAGAAGACAGATGAAGAGCGG - Intronic
962126050 3:132619498-132619520 ATGAAAATTCAGTGGACAAGTGG - Exonic
962799019 3:138873937-138873959 ATGGAAAGACAAAGGAAAAGAGG - Intergenic
963631064 3:147730516-147730538 ATCAAAATAAAGAGGCAAAGAGG + Intergenic
963999471 3:151752388-151752410 ATAAGAATACAATTGAAAAGTGG - Intronic
964317085 3:155456476-155456498 ATGTAAATAGAGCAGAAAAGAGG - Intronic
964740647 3:159961873-159961895 ATAAAAATAAAGATTAAAATAGG - Intergenic
965152009 3:164989624-164989646 ATCACAAGACAGATGAAGAGAGG + Intronic
965401953 3:168223066-168223088 AAGAAAATTCAGAGGAAAAAAGG + Intergenic
965697753 3:171427138-171427160 ATGAAGATATAGATTAACAGTGG - Intronic
965706086 3:171509545-171509567 ATGAAAACACAGTTGGCAAGTGG + Intergenic
965797736 3:172458705-172458727 AAGAAAAGACAGATAGAAAGTGG - Intergenic
965848638 3:172994092-172994114 ATTAAAATACATAATAAAAGGGG - Intronic
966045992 3:175550315-175550337 ATGAAAAAGCAAATAAAAAGTGG + Intronic
966181347 3:177191684-177191706 AAGAATACACAGATAAAAAGTGG + Intronic
966905185 3:184518635-184518657 ATGAAAATACATTAGAAAAGAGG - Intronic
967248068 3:187508796-187508818 CTGAAAAATCAGCTGAAAAGAGG + Intergenic
967432985 3:189409977-189409999 AAGAAAATACAGATAGAAATAGG - Intergenic
967600442 3:191380966-191380988 ATAAAATTAGAAATGAAAAGGGG + Intronic
967670384 3:192226932-192226954 ATGAATATAATGATAAAAAGAGG + Intronic
968396748 4:245585-245607 TTCAAAATACAGATCAAAATGGG + Intergenic
968718968 4:2185419-2185441 GAGAACATATAGATGAAAAGAGG + Intronic
969097686 4:4746223-4746245 AATTAAATACAGATGAAAGGAGG + Intergenic
969161664 4:5264957-5264979 ATGAACATAAAGAAGAAAAATGG - Intronic
969522676 4:7687670-7687692 TTGAAAATTCAGCTGAAAGGTGG - Intronic
969556244 4:7912727-7912749 TGCAAAATAAAGATGAAAAGAGG - Intronic
970544550 4:17114172-17114194 ATGTAGATACAGATGAGATGTGG - Intergenic
970886312 4:20991348-20991370 ATGAAAACACAAATGAGATGAGG + Intronic
971389749 4:26175030-26175052 ATGAGAAAACACATGAAGAGGGG - Intronic
971492479 4:27227887-27227909 AAGAAAACACAAAGGAAAAGAGG + Intergenic
971630194 4:28981642-28981664 ATTAAAAAATAGATGAAATGTGG + Intergenic
971707571 4:30066068-30066090 ATGCAAATAAAGGTGAAAAATGG - Intergenic
972158487 4:36195213-36195235 ATGAAAAATAAGATGGAAAGAGG - Intronic
972669525 4:41201439-41201461 ATGAAACAAAATATGAAAAGTGG + Intronic
972720668 4:41693936-41693958 AAAAAAATCTAGATGAAAAGAGG - Intronic
972765465 4:42149861-42149883 ATGAAAATGGAAATGAGAAGGGG + Intronic
973066513 4:45800859-45800881 ATGAAAATACAAATGAAAGTTGG - Intergenic
973284227 4:48397366-48397388 AAGGAAATACAGAAGGAAAGAGG + Intronic
974552349 4:63394984-63395006 ATGAATGTACAGATAAAATGTGG + Intergenic
975207071 4:71656945-71656967 ATGAGAATACAAATGTAAACTGG + Intergenic
975216759 4:71764397-71764419 ATGAATATACTGATTAATAGTGG - Intronic
975408190 4:74016337-74016359 ATGAAATGCCAAATGAAAAGAGG - Intergenic
975841027 4:78474392-78474414 ATGAAAATTCAGATAAAAATTGG + Intronic
976267166 4:83195300-83195322 AGGCAGATAGAGATGAAAAGGGG + Intergenic
976321615 4:83723469-83723491 ATTAAAATACAGGTGGTAAGTGG - Intergenic
977025900 4:91819511-91819533 ATAAAATCACATATGAAAAGGGG - Intergenic
977280415 4:95032744-95032766 ATGAAAAGATAAATGAAATGTGG - Intronic
977453704 4:97230332-97230354 CTGAAAACTCAGATGAATAGAGG - Intronic
977619324 4:99118851-99118873 ATGAGAATACTCAGGAAAAGTGG + Intergenic
977637827 4:99320752-99320774 ATGCAAATTCTGATTAAAAGGGG - Intronic
977756191 4:100675037-100675059 ATGAAAATACAGGTAATAATGGG - Intronic
977864279 4:102004461-102004483 AATAAAATGCAGAAGAAAAGTGG - Intronic
978067036 4:104417708-104417730 ATGAAGAAACAGATTCAAAGAGG + Intergenic
978293687 4:107177079-107177101 ATGGAAATAGAGATGAAAGATGG - Intronic
978357964 4:107897572-107897594 ATGAAAATACAGCTAAATTGAGG - Intronic
978516695 4:109576436-109576458 ATGCAAATAAACATGAAAAGTGG + Intronic
978836223 4:113152324-113152346 AGCAAAATACAGCTGAAAAGAGG - Intronic
979009471 4:115349235-115349257 ATAAACATGCAGATGAAAAAGGG + Intergenic
979089742 4:116467225-116467247 AAAAAAATACAGAGGAACAGAGG - Intergenic
979157144 4:117410008-117410030 ATGACAATAAAAATAAAAAGAGG + Intergenic
979165917 4:117531205-117531227 ATGGAAATAAACATGAAAACTGG + Intergenic
979745184 4:124204640-124204662 ATGAATATACATATGAAATCAGG - Intergenic
979759457 4:124383106-124383128 AGGAAGCTACAGAAGAAAAGTGG - Intergenic
979777252 4:124605625-124605647 ATGTAGATAGAGAAGAAAAGAGG + Intergenic
979848173 4:125543435-125543457 ATGAAAATAAGGAGGAAAACTGG + Intergenic
980075980 4:128293355-128293377 ATGAAAATACAAATTCAAATAGG - Intergenic
980147066 4:129000194-129000216 AGGAAAATACAGAGAAAAACAGG + Intronic
980203833 4:129691859-129691881 ATGAAAATTCAGATGAGATTTGG + Intergenic
980253207 4:130345104-130345126 ATGAAATTATATATGAAATGTGG + Intergenic
980461990 4:133126182-133126204 ATGAGGATACAGATGGAAACAGG + Intergenic
980683331 4:136192461-136192483 ATGAACAAACAGATGATGAGTGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981426958 4:144614412-144614434 AGGAAATTTCAGGTGAAAAGTGG + Intergenic
981599144 4:146465978-146466000 TAGAAAATACAGAAGGAAAGAGG - Intronic
981947744 4:150368646-150368668 ATAAACATCCACATGAAAAGTGG - Intronic
982186529 4:152807592-152807614 AAGAAAACACAAATGAAAAATGG - Intronic
982279860 4:153672406-153672428 ATAAAATTAGAAATGAAAAGGGG - Intergenic
982659665 4:158191781-158191803 AGGCAAATACAGATGACAAAGGG + Intergenic
982920073 4:161262555-161262577 AGAAAAATACACATAAAAAGGGG - Intergenic
982952995 4:161724199-161724221 AAGAAAATGCAAATGAAGAGAGG + Intronic
983238079 4:165202630-165202652 ATGAAAAAAGAGAAGAAAATGGG + Intronic
983521902 4:168717861-168717883 ATGAGAACACAGAAGAAATGAGG - Intronic
983782362 4:171686022-171686044 ATAAAAATACAGAAGAAACAAGG + Intergenic
983787489 4:171751979-171752001 ATGAAAATACTGATAAGAAAAGG + Intergenic
983996159 4:174184889-174184911 ATTAAAATTCAGTTGAAAAAAGG - Intergenic
984286854 4:177741750-177741772 GTGAAAAAACAGATGACGAGTGG - Intronic
984654669 4:182304988-182305010 ATAAAAAGAGAGAAGAAAAGAGG - Intronic
985216787 4:187661837-187661859 GTGAAAATACAGGCAAAAAGTGG - Intergenic
985275039 4:188229871-188229893 ATAAAAATAAAAATGAAAAAGGG + Intergenic
985343862 4:188981190-188981212 ATGAAAATAGATATCAAAAAAGG + Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986488701 5:8267276-8267298 ATGAGAATACAGAGAAACAGAGG - Intergenic
987199466 5:15560705-15560727 ATGAAATTGCAGAAGAACAGAGG - Intronic
987199469 5:15560750-15560772 ATGAAATTGCAGAAGAACAGAGG - Intronic
987559443 5:19500171-19500193 ATGAAAATACAGTGGAATAAGGG - Intronic
987587694 5:19877467-19877489 ATAAAAGTATAGATGAAAAGGGG + Intronic
987596384 5:20004802-20004824 ATGAATATAAAGAGGAATAGTGG + Intronic
987767755 5:22256794-22256816 ATAAAAATAAAAATAAAAAGTGG + Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988061743 5:26179053-26179075 ATGAAAATAAGGAAGAATAGTGG + Intergenic
989192805 5:38687879-38687901 TTGAAAAGACAAAAGAAAAGAGG - Intergenic
989321493 5:40139934-40139956 ATGAATGTACAGATGAGTAGAGG + Intergenic
989427598 5:41314722-41314744 ATGAGGATACTGAGGAAAAGGGG + Intronic
989667416 5:43872396-43872418 AACAAAATAAAGATGAAAATTGG - Intergenic
989766445 5:45090242-45090264 ATGAAAACAAACATGAAAATGGG + Intergenic
990820355 5:59832898-59832920 ATGGAAAAACAGATGAAAACGGG + Intronic
990861553 5:60333214-60333236 TTTAAAATACAGATGCAAACAGG + Intronic
991444276 5:66682864-66682886 ATTAAAATCCAGATGAAGCGGGG - Intronic
991563849 5:67984268-67984290 ATGCAAATACCCCTGAAAAGTGG + Intergenic
991567289 5:68018708-68018730 ATGGAAACACAGAGTAAAAGTGG + Intergenic
992169216 5:74085687-74085709 ATGAATATACAGATTATAAATGG - Intergenic
992835016 5:80631511-80631533 AAGAGAAGACAGATTAAAAGAGG - Intronic
993071601 5:83171101-83171123 ATTAAAATACAAGAGAAAAGTGG - Intronic
993418793 5:87673556-87673578 GTGAAAATAAATATGAAAAAGGG - Intergenic
993436188 5:87898585-87898607 ATGAAAAGATAGAAGAAAAAAGG + Intergenic
994784446 5:104138530-104138552 AGGAAAAAACAGAAGGAAAGAGG + Intergenic
994828436 5:104746361-104746383 GGGAAAATACAGATGGTAAGTGG - Intergenic
995217550 5:109612961-109612983 TAGAAAATACAGATGAATAAAGG - Intergenic
995419329 5:111945550-111945572 AAGAAGAAACAGAAGAAAAGAGG + Intronic
995857103 5:116605044-116605066 GTGAAAGTACAGATGCACAGGGG - Intergenic
995892979 5:116977472-116977494 AGGAAAGTACATATGAAAACAGG - Intergenic
996256336 5:121408789-121408811 TTGAAAATAAATATGAAAATAGG + Intergenic
996275246 5:121658659-121658681 ATGAAAATAGAAATGTAAATTGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996686732 5:126290785-126290807 ATGAATATGTAGATGAAATGTGG + Intergenic
996703471 5:126472920-126472942 CTGAAAATACTGGGGAAAAGGGG + Intronic
996883518 5:128328019-128328041 ATGAAAATATAAATGAAGAAAGG - Intronic
997077849 5:130702266-130702288 ATAAAATTACAGACAAAAAGAGG + Intergenic
997219132 5:132144560-132144582 ATGAAAATAGAGATGACAGAGGG + Intergenic
997820645 5:137062788-137062810 AGGAAAACACAGTTAAAAAGAGG - Intronic
997869481 5:137494808-137494830 ATGAAGGTACAAATGAACAGAGG + Intronic
998056121 5:139079152-139079174 GTGAAACATCAGATGAAAAGGGG + Intronic
998085490 5:139318743-139318765 ATCAAAATACAAAACAAAAGAGG - Intronic
998223878 5:140311136-140311158 CTGAAAAGACAGAAAAAAAGGGG + Intergenic
998558598 5:143149761-143149783 ATGAAAATAAAGAACAAAGGTGG + Intronic
999019710 5:148151378-148151400 AAGAAAAGAGAGAGGAAAAGAGG + Intergenic
999124125 5:149234141-149234163 ATGATACTACAGATAAACAGAGG + Intronic
999128208 5:149262457-149262479 ATGAAAATACAGATGCTGATTGG - Intergenic
999568539 5:152892732-152892754 ATAAAAATAAAGAAGATAAGTGG - Intergenic
1000004649 5:157172083-157172105 CTGAAAAAACAGAAGAAAACAGG + Intronic
1000231083 5:159316065-159316087 ATGAAAATTTGGAGGAAAAGTGG - Exonic
1000984722 5:167854748-167854770 ATGAATATACATATTTAAAGGGG - Intronic
1001163199 5:169339616-169339638 ATGGAAATAAAGATGAGAAGAGG - Intergenic
1001949790 5:175808211-175808233 ATGAAAATACTGATGCGGAGAGG - Intronic
1002143242 5:177157977-177157999 ATGAAAAGACAAACAAAAAGTGG - Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002429755 5:179196189-179196211 ATTAAATTAGAAATGAAAAGAGG + Intronic
1002802721 6:540852-540874 ATAAAAATACAGAACAGAAGAGG + Intronic
1003732921 6:8846244-8846266 ATCAAAAGAGAGAAGAAAAGAGG - Intergenic
1003769220 6:9278863-9278885 ATAATAATAGAGATGAAAAGGGG + Intergenic
1003836786 6:10080164-10080186 ATGAAAATACAAATGCACTGAGG + Intronic
1003917802 6:10803894-10803916 ATGAAAATAGAGAACAAAAGAGG + Intronic
1004324230 6:14659386-14659408 GAGAAATTACAGATGGAAAGAGG - Intergenic
1004502322 6:16219914-16219936 ATAAAAATAAAAGTGAAAAGGGG + Intergenic
1005022254 6:21429635-21429657 ATGAAAATACAGGTGGATGGGGG - Intergenic
1005179620 6:23089751-23089773 ATCACAATTCAGATGTAAAGAGG - Intergenic
1005217806 6:23552310-23552332 TTGAAGCTACAGGTGAAAAGTGG + Intergenic
1005641244 6:27798524-27798546 ATAAAAATACAGCAGGAAAGGGG - Intergenic
1005791331 6:29304689-29304711 AAGAAAATAAAAATGAAAATAGG + Intergenic
1006307749 6:33234831-33234853 ATGAAAATACAGAGGGGAAGGGG + Intergenic
1006524157 6:34589430-34589452 ATGAAAATACAGCCCCAAAGGGG - Exonic
1007025685 6:38570567-38570589 ATCAGAAAACAGAAGAAAAGAGG - Intronic
1007062567 6:38955272-38955294 ATGCAAATAAAGAGGAAAATGGG - Intronic
1007150062 6:39681376-39681398 ATGAAAATATACATGAACAAGGG - Intronic
1007899641 6:45399169-45399191 GTAGAAATACAGATGAAGAGAGG - Intronic
1007987189 6:46218491-46218513 ATGAGAATAGAGAATAAAAGTGG - Intergenic
1008233586 6:49015558-49015580 ATGAAAATAATGATTGAAAGAGG - Intergenic
1008811629 6:55508024-55508046 ATGAAATGACAGGTGAAAAAGGG + Intronic
1008850715 6:56017632-56017654 ACAAAAATACAGATCAAAATGGG - Intergenic
1008993818 6:57635397-57635419 CTAAAAATACAGAGGAAAACAGG - Intronic
1009182426 6:60534481-60534503 CTAAAAATACAGAGGAAAACAGG - Intergenic
1009272037 6:61625652-61625674 GTGAAAACAGAGAAGAAAAGAGG - Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009669464 6:66728481-66728503 AAGAAAAGACAGACAAAAAGTGG - Intergenic
1009823949 6:68842307-68842329 ATAAAATTAGAGATGAAAAAAGG + Intronic
1009835049 6:68989562-68989584 ATAAAAATAGAGGTTAAAAGTGG - Intronic
1010648685 6:78424910-78424932 AGGCAGATAGAGATGAAAAGGGG - Intergenic
1010766176 6:79778884-79778906 ATGAAAATAGGGAGGAAAACTGG - Intergenic
1011367203 6:86596015-86596037 GTGAAAATACATATTAAAAAAGG - Intergenic
1011552849 6:88545731-88545753 ATGAAAAGAGAGATGATAAGAGG - Intergenic
1011616813 6:89204855-89204877 AAGAAAATACAGATGCAGAATGG - Intronic
1011932691 6:92733900-92733922 ATGAAAATACAGAGCAAACGTGG + Intergenic
1011985188 6:93434811-93434833 ATGAAGAGAAAGAGGAAAAGAGG - Intergenic
1012084785 6:94810357-94810379 ATGAAAATAAACATAAAAAAAGG - Intergenic
1012196866 6:96354020-96354042 ATGGAAGTGCAGAAGAAAAGAGG + Intergenic
1012290186 6:97445544-97445566 ATGAAAAAACAAATTATAAGTGG - Intergenic
1012523637 6:100150923-100150945 ATGAAAAAAAAAATGAAAAGAGG + Intergenic
1012651147 6:101754898-101754920 AAACAAAGACAGATGAAAAGAGG + Intronic
1012790705 6:103691414-103691436 ATAAAAATACAGAAAAATAGTGG - Intergenic
1012818938 6:104060570-104060592 ATGAAAATACAAGTAAAAATTGG + Intergenic
1013113796 6:107085452-107085474 AAGAAAAAACAAAAGAAAAGAGG - Intronic
1013435150 6:110097247-110097269 ATGAAAATACAGATGTGAGATGG + Intergenic
1013824160 6:114191376-114191398 AAGAAAAAACACATGAAAATAGG + Intronic
1014049112 6:116931036-116931058 GTGAAAGTGCAGATGGAAAGAGG + Intronic
1014098657 6:117485864-117485886 ATGAAAATACAGCAGAAAGAAGG + Intronic
1014433184 6:121392935-121392957 ATGAAAATACGGAAGCACAGAGG + Intergenic
1014522322 6:122459874-122459896 ATAAAATTACTGATGAAAAAAGG + Intronic
1014600358 6:123403820-123403842 AAAAAAATACAGGAGAAAAGAGG + Intronic
1014690164 6:124553680-124553702 ATGTAAATATAGCTGAAAAATGG - Intronic
1014733172 6:125058631-125058653 ATCAAAAGAAAGATGAAAAGTGG - Intronic
1014768489 6:125434483-125434505 ATGAAAATAGAGAGCAAAAGTGG + Intergenic
1015015221 6:128404730-128404752 ATGATTTCACAGATGAAAAGAGG + Intronic
1015070932 6:129092059-129092081 ATGAAAACAGAGGTGAAAAGTGG - Intronic
1016242627 6:141949122-141949144 ATTAAAAGACAGATGATAAAAGG + Intergenic
1016299033 6:142609199-142609221 ATGAAATTACAAGTCAAAAGAGG - Intergenic
1016813166 6:148280519-148280541 ATGAACAAATAGATCAAAAGAGG + Intronic
1016926315 6:149352541-149352563 AGGAAAATAGAGATGGAAAGGGG - Intronic
1017033891 6:150250055-150250077 ATCAAAATTCAGATGGAATGTGG + Exonic
1017282660 6:152640384-152640406 GTGAAAAAACAGATTAGAAGTGG + Intergenic
1017339864 6:153308507-153308529 TTGAAATTACAGAAGAAGAGTGG - Intergenic
1017345891 6:153380288-153380310 TTGAAAATACAACTTAAAAGAGG + Intergenic
1017629702 6:156384514-156384536 ATGAAACCACAGAAGCAAAGAGG + Intergenic
1017744418 6:157434129-157434151 AAGAAAATAGAGAAGAAAAACGG + Intronic
1018317896 6:162575476-162575498 GGGAAAATACGGAGGAAAAGCGG - Intronic
1018341075 6:162851663-162851685 ATGAAAATACAGTTTCAAGGGGG - Intronic
1018667717 6:166154877-166154899 AGGAAAATACATATAATAAGAGG + Intergenic
1018674900 6:166211244-166211266 ATGCATATATATATGAAAAGAGG + Intergenic
1018729653 6:166639195-166639217 AAGACAATACAGTTGAATAGGGG - Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1019077570 6:169400576-169400598 ATGAAATAACATATGAAAACAGG - Intergenic
1019554918 7:1624472-1624494 AACAAAAAACAAATGAAAAGAGG - Intergenic
1019582832 7:1775982-1776004 ATTAGAATGGAGATGAAAAGAGG - Intergenic
1019985516 7:4652603-4652625 ATGAAAATACAAAGGAAATTTGG - Intergenic
1020852972 7:13379918-13379940 ATAAAAATAAAAAAGAAAAGTGG - Intergenic
1021117146 7:16756715-16756737 TTGTAAATATAGAAGAAAAGGGG + Intronic
1021250442 7:18318774-18318796 ATAAAGAAACAGAGGAAAAGAGG - Intronic
1021298957 7:18946553-18946575 GAGAAAATAGAGATCAAAAGAGG + Intronic
1021376633 7:19916065-19916087 ATAAAAATGAAGATGAAAGGTGG + Intergenic
1021535237 7:21696251-21696273 AAGAAAATACAAATGAAATATGG - Intronic
1021767100 7:23960783-23960805 AAGAATATGCTGATGAAAAGTGG - Intergenic
1021809667 7:24391134-24391156 GTGAAGATAGAGAAGAAAAGAGG - Intergenic
1022027479 7:26462281-26462303 AGGAAAATTGAGATGTAAAGAGG + Intergenic
1022117224 7:27272602-27272624 ATGTAAATACTAATCAAAAGAGG - Intergenic
1022583271 7:31578814-31578836 ATGAGAACACAGAGGAGAAGTGG - Intronic
1023086959 7:36580589-36580611 AAGAAAATACAGAAACAAAGGGG - Intronic
1023236644 7:38097407-38097429 ATGAAAATAAAGTTGTAAAGAGG - Intergenic
1023913495 7:44571436-44571458 TTGAAGATAGAGATGGAAAGGGG - Intronic
1024137097 7:46420898-46420920 ATGAAGAGAGAGAAGAAAAGGGG - Intergenic
1024873468 7:53993195-53993217 ATGGAGATAAAGATGAAATGGGG + Intergenic
1025319253 7:58075586-58075608 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1025477672 7:60946055-60946077 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1025554449 7:62287605-62287627 ATGAAAAGACAAAGGAAAGGAGG - Intergenic
1025560332 7:62365669-62365691 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1025699454 7:63803919-63803941 ATGAAAAGAGAAATGAAAACAGG - Intergenic
1026076232 7:67172118-67172140 AGAAAAAGACAGCTGAAAAGGGG - Intronic
1026398901 7:69988944-69988966 AGAAAAGTACAGATGGAAAGGGG + Intronic
1026700625 7:72640171-72640193 AGAAAAAGACAGCTGAAAAGGGG + Intronic
1026877209 7:73886624-73886646 AGGAAAACAGAGATGAACAGGGG - Intergenic
1027655726 7:80929062-80929084 ATAAAAATACATATACAAAGTGG + Intergenic
1027725677 7:81802592-81802614 ATAAAAACACAGCAGAAAAGTGG + Intergenic
1027734465 7:81915159-81915181 AAAGAAATACATATGAAAAGTGG - Intergenic
1027822642 7:83067266-83067288 ATGAGATTACACATGAAAAGGGG + Intronic
1028463568 7:91123550-91123572 ATGAATATCCAAATGAGAAGAGG + Intronic
1028498863 7:91495396-91495418 ATGAACAAACAGATAAAATGGGG - Intergenic
1028835499 7:95370168-95370190 ATGAAAAATTTGATGAAAAGAGG + Intronic
1029955102 7:104630464-104630486 AAGAAAAAAAATATGAAAAGTGG + Intronic
1030139651 7:106291784-106291806 AAGAAAATACAGATGGGAGGTGG - Intergenic
1031555978 7:123176892-123176914 ATGAAGATAGAGAAGCAAAGAGG - Intronic
1031662208 7:124439270-124439292 TTGAAAGTAAAGAGGAAAAGAGG + Intergenic
1031792192 7:126119850-126119872 AGGCAGAAACAGATGAAAAGTGG + Intergenic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032464394 7:132134760-132134782 ATGGAAATACAAATGAGACGGGG - Intronic
1032625078 7:133583158-133583180 ATGTAAATAAAGAAGAAGAGAGG - Intronic
1033006622 7:137571817-137571839 AGAAGAATACAGATGGAAAGAGG + Intronic
1034389194 7:150770536-150770558 ATGAAAAAGCAGAGGAAAATTGG + Intergenic
1034585618 7:152089586-152089608 ATGGAAAGACAAAGGAAAAGAGG + Intronic
1036234578 8:7027137-7027159 CTGAAAATACAGTTTTAAAGGGG - Intergenic
1036492034 8:9236648-9236670 TGGAAAACAAAGATGAAAAGTGG - Intergenic
1037150968 8:15634704-15634726 ATGAAAATACAGATCCTAGGAGG - Intronic
1037288676 8:17327964-17327986 ATGAAAATACTTATGAAGTGTGG + Intronic
1037418949 8:18681534-18681556 ATGAAAATTCTGATTAAAATTGG + Intronic
1037921826 8:22812074-22812096 AGGAAATTACATATGCAAAGAGG - Intronic
1037921909 8:22812872-22812894 AGGAAATTACATATGCAAAGAGG - Intronic
1038242351 8:25821648-25821670 AGGAAAGTGGAGATGAAAAGAGG - Intergenic
1038244235 8:25839644-25839666 ATGACAATAGAGATGGAAAGCGG - Intergenic
1038467832 8:27782113-27782135 AGGAAGTTACAGATGAAAAAAGG - Intronic
1038468079 8:27784945-27784967 ATGACAACACAGGTGAAAAATGG - Intronic
1038592282 8:28850651-28850673 ATGAAAAAACAGATGCAGAGAGG + Intronic
1038672482 8:29593391-29593413 AAAAGAATACAGAAGAAAAGAGG - Intergenic
1038923855 8:32115970-32115992 CTTATATTACAGATGAAAAGAGG - Intronic
1038946569 8:32367773-32367795 ATAAAGCTACAGAAGAAAAGAGG - Intronic
1039255276 8:35711777-35711799 ATGAAAATATAGAACAAAAACGG - Intronic
1039599826 8:38826625-38826647 ATGGAAATACAGATTTAGAGAGG + Intronic
1040601453 8:48888405-48888427 GTGAAAAAACAGAAGAACAGAGG - Intergenic
1040705209 8:50117805-50117827 AAGAAAATATAAATGAATAGAGG - Intronic
1040795069 8:51281472-51281494 AAGAAGTTACAGATAAAAAGGGG + Intergenic
1040864620 8:52036193-52036215 ATAAAAATAAAGCTGAAAAAGGG + Intergenic
1040885655 8:52260994-52261016 AAGAAAAGACAGAGCAAAAGAGG + Intronic
1041236673 8:55809804-55809826 AAAGAAATACAGATGAAAATAGG + Intronic
1041328624 8:56698038-56698060 ATGAAAATAGAGGTGAGCAGAGG + Intergenic
1041616203 8:59908956-59908978 ATGAAAATAGAGAAGACAAAAGG + Intergenic
1042239045 8:66644200-66644222 ACCAAAAAACAGAAGAAAAGAGG + Intronic
1043295377 8:78655485-78655507 ATGAAAATTCAGGTCAAAAGAGG - Intergenic
1043507819 8:80920120-80920142 TTGAAAATAAAGATCAAAACAGG - Intergenic
1043852103 8:85227147-85227169 AAAAAAATACTGATTAAAAGAGG - Intronic
1044000692 8:86876584-86876606 ATTAAAATACATAAGAAAAATGG - Intronic
1044050205 8:87492549-87492571 CTAAAAAGAAAGATGAAAAGAGG - Intronic
1044463442 8:92475601-92475623 ATGATAATTCAGATAAAATGAGG - Intergenic
1044863840 8:96550141-96550163 ATGAAAATCAAAATGAAAACAGG + Intronic
1045060175 8:98404090-98404112 TTGAAAAGACTGATCAAAAGAGG - Intronic
1045085116 8:98674078-98674100 GAGAAAATACATATGAAAAATGG + Intronic
1045544400 8:103115391-103115413 AGCAAAATGGAGATGAAAAGAGG + Intergenic
1045551976 8:103180955-103180977 CTGAAAACACAGCTCAAAAGGGG + Intronic
1046070319 8:109244842-109244864 ATGAAAATACTTATGGAAAGCGG - Intronic
1046291857 8:112172661-112172683 ATAAAAATACAGATGATGAAAGG - Intergenic
1046455585 8:114455630-114455652 ATGAAGAGAAAGGTGAAAAGGGG - Intergenic
1047176528 8:122546230-122546252 ATAAAAATACAACTGGAAAGAGG + Intergenic
1047368123 8:124231206-124231228 ATGAAAATAAAAATTAAAAATGG - Intergenic
1047513299 8:125531813-125531835 ATGAACAGCCAGATGAAGAGGGG + Intergenic
1048172138 8:132117396-132117418 ATGTAGATAGAAATGAAAAGAGG - Intergenic
1048229596 8:132625214-132625236 ATAAAAATATAGTTGATAAGTGG + Intronic
1048519050 8:135137073-135137095 ATAAAAATAAAAATAAAAAGTGG + Intergenic
1050780825 9:9332728-9332750 ATGAAAATACATTTGTACAGAGG + Intronic
1050980266 9:12002533-12002555 CTGAAAATACAGAAGAATAGTGG + Intergenic
1051065859 9:13102270-13102292 CTGAAAATATGGATGTAAAGAGG + Intergenic
1051219863 9:14836915-14836937 ATGCAGATAGAGAGGAAAAGGGG + Intronic
1051253078 9:15181794-15181816 ATGACAAAAAAGATGAAGAGAGG - Intronic
1051980615 9:23011083-23011105 AATAAAATACAGAAGAAAATAGG + Intergenic
1052067314 9:24038101-24038123 ATGAAAAGACACATGAAGAGTGG - Intergenic
1052118935 9:24684568-24684590 GAGAAAATACAGAGGCAAAGTGG - Intergenic
1052776245 9:32736187-32736209 ATTCAAATACAGAGGGAAAGAGG - Intergenic
1053722094 9:40956844-40956866 ATGAAGATGCAGATGACAAATGG + Intergenic
1054742488 9:68821996-68822018 ATGAAAATACACATAATAAAAGG + Intronic
1055665138 9:78545586-78545608 AGCAAAATGCAGACGAAAAGAGG + Intergenic
1055940084 9:81641223-81641245 ATAAAAATAAAGAAGAAAACTGG + Intronic
1056207331 9:84333174-84333196 AAGATAATACAGACGAAATGGGG + Intronic
1056979562 9:91296573-91296595 ATGAAAACAGACATGAAAAGAGG - Intronic
1057037873 9:91824861-91824883 AAGAAAATACAGCTGGCAAGAGG - Intronic
1057094044 9:92288732-92288754 ATGAAAATAAAGGTGGAAAGAGG + Intronic
1057106495 9:92422715-92422737 ATGAGCATATAGATGAAAACAGG - Intronic
1057490985 9:95519347-95519369 ATGAAAAGACAAAGGAAAACAGG - Intergenic
1057614169 9:96573320-96573342 AAAAAAATACAGATGAGAATCGG + Intronic
1058485307 9:105438076-105438098 ATGAATACACAGTTGATAAGGGG + Intronic
1058551876 9:106123496-106123518 GTGAGAATAGAGAGGAAAAGTGG + Intergenic
1058914143 9:109549309-109549331 ATGAAAAAACAGATTAGGAGAGG - Intergenic
1058937432 9:109781824-109781846 ATCAAAATACACATGCACAGGGG - Intronic
1059596966 9:115731228-115731250 AAGAAAGTGAAGATGAAAAGGGG - Intergenic
1059684763 9:116624491-116624513 ATGAGAATACAGAAGGAAGGGGG + Intronic
1059779699 9:117513479-117513501 ATTAAAAAACAGATAGAAAGTGG + Intergenic
1059894497 9:118846211-118846233 ATGAAAGTAAAGATCAAATGGGG + Intergenic
1059940832 9:119358163-119358185 ATGAGAATAAGGATGAAGAGGGG + Intronic
1060441615 9:123644956-123644978 ATGAAAATATGGAAGAAAAATGG + Intronic
1060483643 9:124033070-124033092 ATAAATATACAGAGAAAAAGAGG - Exonic
1060542274 9:124438963-124438985 AGGAAAACACAGAGGCAAAGAGG - Intergenic
1061985965 9:134130414-134130436 ATAAAAATAAAGATAAAAATAGG + Intergenic
1062125587 9:134859764-134859786 ATGGAAAGACAAAGGAAAAGAGG - Intergenic
1062203990 9:135325667-135325689 ATGAAAATCCAGATGTGCAGGGG - Intergenic
1185772161 X:2773138-2773160 ATGAAAGGACAGAGGAAAACAGG + Intronic
1186124763 X:6401233-6401255 ATGAGAACAAAGAAGAAAAGAGG - Intergenic
1186421356 X:9429533-9429555 ATAAAAATAAAAATAAAAAGTGG - Intergenic
1187198701 X:17114019-17114041 ATGACAAAACAGTAGAAAAGAGG + Intronic
1188289986 X:28375759-28375781 ATGTAAATATACATGAAAATAGG + Intergenic
1188309535 X:28599593-28599615 ATTAAAATACATATGGGAAGGGG - Intronic
1188388646 X:29592574-29592596 ATGAAAAGAGAGGTGAAACGAGG - Intronic
1189065546 X:37804585-37804607 ATGAATAGATAAATGAAAAGTGG + Intronic
1189525497 X:41815796-41815818 ATTAAAATACAAATAAAAAAAGG + Intronic
1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG + Intergenic
1190181854 X:48198967-48198989 CTGAAAATACAGAACAAAATGGG + Intronic
1190194897 X:48308454-48308476 CTGAAAATACAGAACAAAATGGG + Intergenic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190298406 X:49042114-49042136 ATGAAAGTAAGGATGAGAAGAGG + Intronic
1191755949 X:64592511-64592533 ATGAGAAAACAGATTTAAAGAGG + Intergenic
1192212820 X:69138379-69138401 ATTAAAATCCAGATCAACAGTGG + Intergenic
1192263993 X:69525937-69525959 GTGAAAAAACAGGTGAAAATAGG - Intronic
1192334532 X:70206253-70206275 AGGAAAATGAAGCTGAAAAGTGG - Intergenic
1192840259 X:74848058-74848080 ATGGGAATACAGAAGAAAATTGG - Intronic
1193526133 X:82591794-82591816 GTGAGAATAAAAATGAAAAGGGG - Intergenic
1194044859 X:88989897-88989919 ATGAGAAATCAGATGAAAACTGG + Intergenic
1194278112 X:91912935-91912957 CTGAAAATCCAGATCACAAGAGG + Intronic
1194601030 X:95922124-95922146 AGGAAAATGAAGATGAAGAGAGG + Intergenic
1194615049 X:96090008-96090030 ATGCAAATGGAAATGAAAAGTGG + Intergenic
1194615345 X:96094361-96094383 ATGAAAATAAATATGTAAACTGG + Intergenic
1194995749 X:100589760-100589782 CTAACATTACAGATGAAAAGGGG + Intronic
1195261704 X:103138480-103138502 ATTTAAAAACAGATGAAATGGGG - Intergenic
1195533771 X:105987160-105987182 AAGTAAATAGAGAAGAAAAGTGG + Intergenic
1195718125 X:107838570-107838592 ATGAAAATCTATATGAAATGAGG - Intronic
1195915263 X:109929172-109929194 ATGGAAATACAGAGGAAAATTGG + Intergenic
1196003845 X:110814479-110814501 ATGTAGATAAAGAAGAAAAGAGG + Intergenic
1196631634 X:117947437-117947459 ATGAAACTGCAGATGTAAAAGGG + Intronic
1197127468 X:122964396-122964418 TGGAAAATACAGATGAATACAGG + Intergenic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1198425209 X:136511688-136511710 AAGAATATGCAGATGAAAAGGGG + Exonic
1198562254 X:137863660-137863682 ATAAAAATACTGAATAAAAGGGG - Intergenic
1198718187 X:139585075-139585097 ATGAAAATGAAGAAGAAAATAGG - Exonic
1198927782 X:141818633-141818655 ATGAAAATAGTGTTCAAAAGGGG + Intergenic
1199123424 X:144085629-144085651 ATAAATGCACAGATGAAAAGAGG + Intergenic
1199268424 X:145855199-145855221 ATGAAAGGGCAAATGAAAAGTGG + Intergenic
1199424089 X:147681389-147681411 CTGAAAATCCAGATCATAAGAGG + Intergenic
1199578991 X:149342830-149342852 ATGAAAATGGAGAGGAAAATCGG + Intergenic
1200595454 Y:5135010-5135032 CTGAAAATCCAGATCACAAGAGG + Intronic
1200766966 Y:7088300-7088322 ATGAAAATGCAGATGAATGGGGG - Intronic
1201350838 Y:13039304-13039326 AAGAAAATACAGGAGAATAGTGG + Intergenic
1201606644 Y:15792921-15792943 ATGAGAACAAAGAAGAAAAGAGG - Intergenic
1201645761 Y:16229951-16229973 AGGAAAAGACAGAGGAAGAGGGG + Intergenic
1201657052 Y:16355365-16355387 AGGAAAAGACAGAGGAAGAGGGG - Intergenic
1202332211 Y:23766687-23766709 ATGAAAATATAGATGAAAGACGG + Intergenic
1202349406 Y:23971811-23971833 ATTAAAATATAGATGAATAATGG + Intergenic
1202521369 Y:25698293-25698315 ATTAAAATATAGATGAATAATGG - Intergenic
1202538558 Y:25903376-25903398 ATGAAAATATAGATGAAAGACGG - Intergenic