ID: 1169877305

View in Genome Browser
Species Human (GRCh38)
Location 20:10312103-10312125
Sequence GACCATGAGACAAGGTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169877305_1169877307 2 Left 1169877305 20:10312103-10312125 CCAGAAAACCTTGTCTCATGGTC No data
Right 1169877307 20:10312128-10312150 CTCTTCAGAGAGTCCTACTAAGG No data
1169877305_1169877309 24 Left 1169877305 20:10312103-10312125 CCAGAAAACCTTGTCTCATGGTC No data
Right 1169877309 20:10312150-10312172 GCAACACCTTCACAAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169877305 Original CRISPR GACCATGAGACAAGGTTTTC TGG (reversed) Intergenic
No off target data available for this crispr