ID: 1169877306

View in Genome Browser
Species Human (GRCh38)
Location 20:10312111-10312133
Sequence GAAGAGCAGACCATGAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169877306_1169877307 -6 Left 1169877306 20:10312111-10312133 CCTTGTCTCATGGTCTGCTCTTC No data
Right 1169877307 20:10312128-10312150 CTCTTCAGAGAGTCCTACTAAGG No data
1169877306_1169877309 16 Left 1169877306 20:10312111-10312133 CCTTGTCTCATGGTCTGCTCTTC No data
Right 1169877309 20:10312150-10312172 GCAACACCTTCACAAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169877306 Original CRISPR GAAGAGCAGACCATGAGACA AGG (reversed) Intergenic