ID: 1169877309

View in Genome Browser
Species Human (GRCh38)
Location 20:10312150-10312172
Sequence GCAACACCTTCACAAGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169877305_1169877309 24 Left 1169877305 20:10312103-10312125 CCAGAAAACCTTGTCTCATGGTC No data
Right 1169877309 20:10312150-10312172 GCAACACCTTCACAAGATTCAGG No data
1169877306_1169877309 16 Left 1169877306 20:10312111-10312133 CCTTGTCTCATGGTCTGCTCTTC No data
Right 1169877309 20:10312150-10312172 GCAACACCTTCACAAGATTCAGG No data
1169877304_1169877309 25 Left 1169877304 20:10312102-10312124 CCCAGAAAACCTTGTCTCATGGT No data
Right 1169877309 20:10312150-10312172 GCAACACCTTCACAAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169877309 Original CRISPR GCAACACCTTCACAAGATTC AGG Intergenic