ID: 1169877884

View in Genome Browser
Species Human (GRCh38)
Location 20:10317750-10317772
Sequence CCGTGGTGCTGTACTACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169877884_1169877886 -8 Left 1169877884 20:10317750-10317772 CCTGCAGTAGTACAGCACCACGG No data
Right 1169877886 20:10317765-10317787 CACCACGGTCTGCAATTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169877884 Original CRISPR CCGTGGTGCTGTACTACTGC AGG (reversed) Intergenic