ID: 1169879276

View in Genome Browser
Species Human (GRCh38)
Location 20:10328942-10328964
Sequence CTTGGGGCCCAGAAAAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169879276_1169879282 -5 Left 1169879276 20:10328942-10328964 CCCTGATTTTTCTGGGCCCCAAG No data
Right 1169879282 20:10328960-10328982 CCAAGCTGGTATGCTGCCCCAGG No data
1169879276_1169879283 6 Left 1169879276 20:10328942-10328964 CCCTGATTTTTCTGGGCCCCAAG No data
Right 1169879283 20:10328971-10328993 TGCTGCCCCAGGAAGACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169879276 Original CRISPR CTTGGGGCCCAGAAAAATCA GGG (reversed) Intergenic
No off target data available for this crispr