ID: 1169879282

View in Genome Browser
Species Human (GRCh38)
Location 20:10328960-10328982
Sequence CCAAGCTGGTATGCTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169879277_1169879282 -6 Left 1169879277 20:10328943-10328965 CCTGATTTTTCTGGGCCCCAAGC No data
Right 1169879282 20:10328960-10328982 CCAAGCTGGTATGCTGCCCCAGG No data
1169879271_1169879282 20 Left 1169879271 20:10328917-10328939 CCATTACTTAATTTCTTGGTGCC No data
Right 1169879282 20:10328960-10328982 CCAAGCTGGTATGCTGCCCCAGG No data
1169879270_1169879282 21 Left 1169879270 20:10328916-10328938 CCCATTACTTAATTTCTTGGTGC No data
Right 1169879282 20:10328960-10328982 CCAAGCTGGTATGCTGCCCCAGG No data
1169879275_1169879282 -4 Left 1169879275 20:10328941-10328963 CCCCTGATTTTTCTGGGCCCCAA No data
Right 1169879282 20:10328960-10328982 CCAAGCTGGTATGCTGCCCCAGG No data
1169879274_1169879282 -1 Left 1169879274 20:10328938-10328960 CCTCCCCTGATTTTTCTGGGCCC No data
Right 1169879282 20:10328960-10328982 CCAAGCTGGTATGCTGCCCCAGG No data
1169879276_1169879282 -5 Left 1169879276 20:10328942-10328964 CCCTGATTTTTCTGGGCCCCAAG No data
Right 1169879282 20:10328960-10328982 CCAAGCTGGTATGCTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169879282 Original CRISPR CCAAGCTGGTATGCTGCCCC AGG Intergenic
No off target data available for this crispr