ID: 1169879283

View in Genome Browser
Species Human (GRCh38)
Location 20:10328971-10328993
Sequence TGCTGCCCCAGGAAGACCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169879275_1169879283 7 Left 1169879275 20:10328941-10328963 CCCCTGATTTTTCTGGGCCCCAA No data
Right 1169879283 20:10328971-10328993 TGCTGCCCCAGGAAGACCATAGG No data
1169879274_1169879283 10 Left 1169879274 20:10328938-10328960 CCTCCCCTGATTTTTCTGGGCCC No data
Right 1169879283 20:10328971-10328993 TGCTGCCCCAGGAAGACCATAGG No data
1169879277_1169879283 5 Left 1169879277 20:10328943-10328965 CCTGATTTTTCTGGGCCCCAAGC No data
Right 1169879283 20:10328971-10328993 TGCTGCCCCAGGAAGACCATAGG No data
1169879276_1169879283 6 Left 1169879276 20:10328942-10328964 CCCTGATTTTTCTGGGCCCCAAG No data
Right 1169879283 20:10328971-10328993 TGCTGCCCCAGGAAGACCATAGG No data
1169879279_1169879283 -10 Left 1169879279 20:10328958-10328980 CCCCAAGCTGGTATGCTGCCCCA No data
Right 1169879283 20:10328971-10328993 TGCTGCCCCAGGAAGACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169879283 Original CRISPR TGCTGCCCCAGGAAGACCAT AGG Intergenic
No off target data available for this crispr