ID: 1169879446

View in Genome Browser
Species Human (GRCh38)
Location 20:10330554-10330576
Sequence TGATTATTTATTAATATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169879446_1169879448 9 Left 1169879446 20:10330554-10330576 CCTTCAATATTAATAAATAATCA No data
Right 1169879448 20:10330586-10330608 TACTGCGTGTTGAAAGATACGGG No data
1169879446_1169879447 8 Left 1169879446 20:10330554-10330576 CCTTCAATATTAATAAATAATCA No data
Right 1169879447 20:10330585-10330607 CTACTGCGTGTTGAAAGATACGG No data
1169879446_1169879449 20 Left 1169879446 20:10330554-10330576 CCTTCAATATTAATAAATAATCA No data
Right 1169879449 20:10330597-10330619 GAAAGATACGGGAAATACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169879446 Original CRISPR TGATTATTTATTAATATTGA AGG (reversed) Intergenic
No off target data available for this crispr