ID: 1169879448

View in Genome Browser
Species Human (GRCh38)
Location 20:10330586-10330608
Sequence TACTGCGTGTTGAAAGATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169879446_1169879448 9 Left 1169879446 20:10330554-10330576 CCTTCAATATTAATAAATAATCA No data
Right 1169879448 20:10330586-10330608 TACTGCGTGTTGAAAGATACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169879448 Original CRISPR TACTGCGTGTTGAAAGATAC GGG Intergenic
No off target data available for this crispr