ID: 1169880526

View in Genome Browser
Species Human (GRCh38)
Location 20:10341796-10341818
Sequence TACCCAAGTCTGGCTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169880526_1169880528 -5 Left 1169880526 20:10341796-10341818 CCAGACACAGCCAGACTTGGGTA No data
Right 1169880528 20:10341814-10341836 GGGTAGATATCCAGATGACCTGG No data
1169880526_1169880531 6 Left 1169880526 20:10341796-10341818 CCAGACACAGCCAGACTTGGGTA No data
Right 1169880531 20:10341825-10341847 CAGATGACCTGGAGGCAGATAGG No data
1169880526_1169880529 -2 Left 1169880526 20:10341796-10341818 CCAGACACAGCCAGACTTGGGTA No data
Right 1169880529 20:10341817-10341839 TAGATATCCAGATGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169880526 Original CRISPR TACCCAAGTCTGGCTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr