ID: 1169883851

View in Genome Browser
Species Human (GRCh38)
Location 20:10376150-10376172
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169883851_1169883859 17 Left 1169883851 20:10376150-10376172 CCAACCAGAAATCTCCACGGAAC No data
Right 1169883859 20:10376190-10376212 TTATTGGAATTTTATTACCTGGG No data
1169883851_1169883856 1 Left 1169883851 20:10376150-10376172 CCAACCAGAAATCTCCACGGAAC No data
Right 1169883856 20:10376174-10376196 TCGGTGTCCAGAGTTCTTATTGG No data
1169883851_1169883858 16 Left 1169883851 20:10376150-10376172 CCAACCAGAAATCTCCACGGAAC No data
Right 1169883858 20:10376189-10376211 CTTATTGGAATTTTATTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169883851 Original CRISPR GTTCCGTGGAGATTTCTGGT TGG (reversed) Intergenic