ID: 1169883852

View in Genome Browser
Species Human (GRCh38)
Location 20:10376154-10376176
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169883852_1169883858 12 Left 1169883852 20:10376154-10376176 CCAGAAATCTCCACGGAACCTCG No data
Right 1169883858 20:10376189-10376211 CTTATTGGAATTTTATTACCTGG No data
1169883852_1169883859 13 Left 1169883852 20:10376154-10376176 CCAGAAATCTCCACGGAACCTCG No data
Right 1169883859 20:10376190-10376212 TTATTGGAATTTTATTACCTGGG No data
1169883852_1169883856 -3 Left 1169883852 20:10376154-10376176 CCAGAAATCTCCACGGAACCTCG No data
Right 1169883856 20:10376174-10376196 TCGGTGTCCAGAGTTCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169883852 Original CRISPR CGAGGTTCCGTGGAGATTTC TGG (reversed) Intergenic