ID: 1169883854

View in Genome Browser
Species Human (GRCh38)
Location 20:10376164-10376186
Sequence CTCTGGACACCGAGGTTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169883854_1169883858 2 Left 1169883854 20:10376164-10376186 CCACGGAACCTCGGTGTCCAGAG No data
Right 1169883858 20:10376189-10376211 CTTATTGGAATTTTATTACCTGG No data
1169883854_1169883859 3 Left 1169883854 20:10376164-10376186 CCACGGAACCTCGGTGTCCAGAG No data
Right 1169883859 20:10376190-10376212 TTATTGGAATTTTATTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169883854 Original CRISPR CTCTGGACACCGAGGTTCCG TGG (reversed) Intergenic