ID: 1169883858

View in Genome Browser
Species Human (GRCh38)
Location 20:10376189-10376211
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169883851_1169883858 16 Left 1169883851 20:10376150-10376172 CCAACCAGAAATCTCCACGGAAC No data
Right 1169883858 20:10376189-10376211 CTTATTGGAATTTTATTACCTGG No data
1169883854_1169883858 2 Left 1169883854 20:10376164-10376186 CCACGGAACCTCGGTGTCCAGAG No data
Right 1169883858 20:10376189-10376211 CTTATTGGAATTTTATTACCTGG No data
1169883855_1169883858 -6 Left 1169883855 20:10376172-10376194 CCTCGGTGTCCAGAGTTCTTATT No data
Right 1169883858 20:10376189-10376211 CTTATTGGAATTTTATTACCTGG No data
1169883852_1169883858 12 Left 1169883852 20:10376154-10376176 CCAGAAATCTCCACGGAACCTCG No data
Right 1169883858 20:10376189-10376211 CTTATTGGAATTTTATTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169883858 Original CRISPR CTTATTGGAATTTTATTACC TGG Intergenic
No off target data available for this crispr