ID: 1169883859

View in Genome Browser
Species Human (GRCh38)
Location 20:10376190-10376212
Sequence TTATTGGAATTTTATTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169883851_1169883859 17 Left 1169883851 20:10376150-10376172 CCAACCAGAAATCTCCACGGAAC No data
Right 1169883859 20:10376190-10376212 TTATTGGAATTTTATTACCTGGG No data
1169883852_1169883859 13 Left 1169883852 20:10376154-10376176 CCAGAAATCTCCACGGAACCTCG No data
Right 1169883859 20:10376190-10376212 TTATTGGAATTTTATTACCTGGG No data
1169883854_1169883859 3 Left 1169883854 20:10376164-10376186 CCACGGAACCTCGGTGTCCAGAG No data
Right 1169883859 20:10376190-10376212 TTATTGGAATTTTATTACCTGGG No data
1169883855_1169883859 -5 Left 1169883855 20:10376172-10376194 CCTCGGTGTCCAGAGTTCTTATT No data
Right 1169883859 20:10376190-10376212 TTATTGGAATTTTATTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169883859 Original CRISPR TTATTGGAATTTTATTACCT GGG Intergenic
No off target data available for this crispr