ID: 1169889416

View in Genome Browser
Species Human (GRCh38)
Location 20:10436166-10436188
Sequence GCAACAAGGCCCTAAGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169889416_1169889422 19 Left 1169889416 20:10436166-10436188 CCAGTTACTTAGGGCCTTGTTGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1169889422 20:10436208-10436230 CCACCAGCATCAGCATCCCTGGG 0: 1
1: 12
2: 80
3: 491
4: 1968
1169889416_1169889420 18 Left 1169889416 20:10436166-10436188 CCAGTTACTTAGGGCCTTGTTGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1169889420 20:10436207-10436229 ACCACCAGCATCAGCATCCCTGG 0: 1
1: 6
2: 31
3: 116
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169889416 Original CRISPR GCAACAAGGCCCTAAGTAAC TGG (reversed) Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
1073500660 10:103933979-103934001 GCTACAAGGCCACAAGTGACAGG - Intergenic
1076517781 10:131058511-131058533 GCCATAAGGCCCTAAGGAAATGG + Intergenic
1086345688 11:85893500-85893522 GAAACAACGCCCTAAGTCAGGGG + Intronic
1090917928 11:131182695-131182717 TTAACAAGGCCCTAGGTTACTGG + Intergenic
1094102059 12:26775379-26775401 GCAACAAGGTAAAAAGTAACAGG + Intronic
1100210746 12:92396185-92396207 GTAGCAAGGCACCAAGTAACTGG - Intergenic
1102328469 12:112010223-112010245 GAAACAAGGCTTTATGTAACTGG - Intronic
1105835579 13:24208265-24208287 GCAACAAAGCCCTCAATTACAGG - Intronic
1113696945 13:112353861-112353883 GAAACAAGGCCTTCAGTGACAGG + Intergenic
1116281804 14:42917631-42917653 AAAAGAAGGCCCTAAGTAATTGG - Intergenic
1120286117 14:82504233-82504255 CAAACAATTCCCTAAGTAACAGG + Intergenic
1121618793 14:95332022-95332044 GCCTCAAGGCCCTAAGGAAGAGG - Intergenic
1137744645 16:50811916-50811938 GCATCAAGGACCTCAGTCACTGG + Intergenic
1139581857 16:67878506-67878528 GCAACAAGGCAGTGAGTGACTGG - Intronic
1142613871 17:1124083-1124105 GCAACAAGGGCCTTGGCAACGGG - Intronic
1150158917 17:62877652-62877674 GCCACAAGCCCCAAAATAACAGG + Intergenic
1153151798 18:2104615-2104637 GTAACAAGTCCCTAAATAAATGG - Intergenic
1160073254 18:75647194-75647216 GCAGGAAGGCTCTAAGAAACCGG + Intergenic
1165394365 19:35556322-35556344 GTAACAAGGCCCGATGTAACAGG + Intronic
1165693549 19:37883284-37883306 TCATTAAGTCCCTAAGTAACTGG + Intergenic
1167892740 19:52555051-52555073 GCAGCAAGACCTTCAGTAACAGG + Exonic
1168320106 19:55503990-55504012 GCAACCAGGCCCCAAGAAGCGGG + Intronic
925947068 2:8875037-8875059 GAAACAAGGACCAAAATAACAGG - Intronic
928635139 2:33237833-33237855 GCAAGAAGGCCCTGAGGAAAGGG + Intronic
932312415 2:70754405-70754427 GCACCCAGGCCCTGAGTACCTGG - Intronic
933047787 2:77559686-77559708 TTAACAAAGCCCTAATTAACAGG - Intronic
939533819 2:143399508-143399530 GCAACAAGGAACTAAGTTGCTGG + Intronic
948339794 2:237240342-237240364 GGAATAAGGCCCTCAGCAACAGG + Intergenic
1169889416 20:10436166-10436188 GCAACAAGGCCCTAAGTAACTGG - Intronic
1169931211 20:10835087-10835109 TCATCAAAGCCATAAGTAACAGG + Intergenic
950132008 3:10553813-10553835 CCACCCAGGCCCTTAGTAACGGG - Intronic
974337959 4:60576082-60576104 TTAACAAGGCACAAAGTAACAGG + Intergenic
983622482 4:169775086-169775108 GCAGCCAGGCCCTTAGAAACGGG - Intergenic
984872742 4:184341566-184341588 GCAACAAGGACCTATGGAAAGGG + Intergenic
987559053 5:19495087-19495109 GCAACAAGTGCCTGAGAAACAGG + Intronic
992639611 5:78757773-78757795 GCCACAAGGCCTTATGCAACAGG - Intronic
1003495735 6:6661672-6661694 GCAATAAAGCTCTAAGTAACTGG - Intergenic
1006349496 6:33510582-33510604 GAAACAAGGCCCCAAGTGACTGG + Intergenic
1010660644 6:78566914-78566936 CCAACAATGCCCCTAGTAACAGG + Intergenic
1013689010 6:112617772-112617794 CCACCAAGGACCTAAGTACCCGG + Intergenic
1014966428 6:127758898-127758920 GCACCAATTACCTAAGTAACTGG - Intronic
1018084899 6:160292399-160292421 TCAACAATGCTGTAAGTAACTGG + Intergenic
1018826622 6:167412608-167412630 GCAACAAGGCAACGAGTAACTGG + Intergenic
1020989244 7:15176238-15176260 GGAACAAAGCCCGAAGAAACAGG - Intergenic
1021399311 7:20191440-20191462 GCAACCTGGCCCTACGTAGCTGG + Intronic
1033113987 7:138609210-138609232 GCAACAAGGCTCTCAGGCACTGG + Intronic
1041921470 8:63187001-63187023 GCAACAAGGACCTCAGCCACAGG + Exonic
1044685530 8:94822811-94822833 TCAACTAGGCTCTAAGTATCGGG + Intronic
1045296873 8:100879117-100879139 GCCACAAAGCACTAAGTATCTGG + Intergenic
1045777757 8:105825785-105825807 TTAACAAGGCCTTAAGTCACTGG + Intergenic
1048215820 8:132493787-132493809 GTTACATGGCCATAAGTAACTGG - Intergenic
1048912183 8:139146138-139146160 GCAACACAGCCGTAAGTGACAGG - Intergenic
1053090144 9:35267854-35267876 TCAAGAAGCCTCTAAGTAACAGG - Intronic
1055311448 9:74985924-74985946 TAAACAAGGCACTAAGTAAATGG + Intronic
1057079565 9:92162607-92162629 GCCATAAGGCCCTAAGGAAATGG + Intergenic
1058498784 9:105589944-105589966 CTTACAAGACCCTAAGTAACAGG - Intronic
1198031284 X:132755883-132755905 CCAACAAGGCCCAAACTAAAGGG - Intronic
1198883496 X:141307079-141307101 GCAACAACGCAGTAAGTACCTGG + Intergenic