ID: 1169889416

View in Genome Browser
Species Human (GRCh38)
Location 20:10436166-10436188
Sequence GCAACAAGGCCCTAAGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169889416_1169889422 19 Left 1169889416 20:10436166-10436188 CCAGTTACTTAGGGCCTTGTTGC No data
Right 1169889422 20:10436208-10436230 CCACCAGCATCAGCATCCCTGGG No data
1169889416_1169889420 18 Left 1169889416 20:10436166-10436188 CCAGTTACTTAGGGCCTTGTTGC No data
Right 1169889420 20:10436207-10436229 ACCACCAGCATCAGCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169889416 Original CRISPR GCAACAAGGCCCTAAGTAAC TGG (reversed) Intronic