ID: 1169889420

View in Genome Browser
Species Human (GRCh38)
Location 20:10436207-10436229
Sequence ACCACCAGCATCAGCATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169889417_1169889420 4 Left 1169889417 20:10436180-10436202 CCTTGTTGCTCCAAGTTCATTTC No data
Right 1169889420 20:10436207-10436229 ACCACCAGCATCAGCATCCCTGG No data
1169889416_1169889420 18 Left 1169889416 20:10436166-10436188 CCAGTTACTTAGGGCCTTGTTGC No data
Right 1169889420 20:10436207-10436229 ACCACCAGCATCAGCATCCCTGG No data
1169889418_1169889420 -6 Left 1169889418 20:10436190-10436212 CCAAGTTCATTTCACCTACCACC No data
Right 1169889420 20:10436207-10436229 ACCACCAGCATCAGCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169889420 Original CRISPR ACCACCAGCATCAGCATCCC TGG Intronic