ID: 1169889945

View in Genome Browser
Species Human (GRCh38)
Location 20:10441486-10441508
Sequence CATCCCATGCAGTGGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169889941_1169889945 -10 Left 1169889941 20:10441473-10441495 CCTATTAGTAAAGCATCCCATGC 0: 1
1: 0
2: 0
3: 8
4: 62
Right 1169889945 20:10441486-10441508 CATCCCATGCAGTGGCTGGTGGG 0: 1
1: 1
2: 1
3: 12
4: 190
1169889940_1169889945 4 Left 1169889940 20:10441459-10441481 CCTACTAAATTTTGCCTATTAGT 0: 1
1: 0
2: 1
3: 16
4: 455
Right 1169889945 20:10441486-10441508 CATCCCATGCAGTGGCTGGTGGG 0: 1
1: 1
2: 1
3: 12
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169889945 Original CRISPR CATCCCATGCAGTGGCTGGT GGG Intronic
901037500 1:6345109-6345131 CATCCGAGGCACTGGCTGCTGGG - Intronic
901940301 1:12656764-12656786 CATACCAGGCAGTGGATGGATGG - Intronic
902623524 1:17664094-17664116 CATGCCATGCACTGGGTGCTGGG - Intronic
905337537 1:37255846-37255868 AAACCCATGAAGGGGCTGGTAGG - Intergenic
905436193 1:37956878-37956900 CATCCCATGCAGAGGCAGGCTGG - Intergenic
906061512 1:42952189-42952211 TATCACATTCTGTGGCTGGTGGG + Intronic
907351471 1:53835499-53835521 CATCCTATACAGTGGCTGTCTGG - Exonic
908257188 1:62312663-62312685 CATCCCATGCCCTGGCTGCCTGG + Intronic
908363281 1:63390847-63390869 CATGCCATGCAGCTGCTGCTGGG + Intronic
911061414 1:93751270-93751292 CCTCCCATGCAGTGGGTGACAGG + Intronic
915363936 1:155303211-155303233 CATCCCAAGATGGGGCTGGTTGG - Intergenic
916326202 1:163562582-163562604 CATCCCATGCATGTGATGGTTGG - Intergenic
917677879 1:177337642-177337664 CATCTGATGCAGTGGGTTGTGGG - Intergenic
918825390 1:189316945-189316967 ATTCCCAAGCTGTGGCTGGTAGG - Intergenic
919777195 1:201201959-201201981 CATCCCATGGAGTTCCTGGCTGG + Intronic
922790500 1:228308400-228308422 CACCCCATGCAGTCACTGGTGGG - Intronic
923881437 1:238108350-238108372 CATCCCATGCAGTGTCAGCAAGG + Intergenic
924517775 1:244780615-244780637 CATCCCACGGAGGGGCAGGTGGG - Intergenic
1063100428 10:2945446-2945468 AATCACATGCAGAGGCTGGCTGG - Intergenic
1064067679 10:12196408-12196430 CCTCCCATGCAGTCGCTAGAAGG - Intronic
1064289773 10:14023031-14023053 CATCCCAGGCAGTGGCAGCCAGG + Intronic
1064951005 10:20850239-20850261 GATCCCAGGCAGTGGGTGGCTGG + Intronic
1065637270 10:27744660-27744682 CAGCCCATGCCGCGGCTGGACGG - Intronic
1066620742 10:37346471-37346493 CATCACATGCTGTGGCCTGTTGG - Intronic
1067089045 10:43257396-43257418 CCACCCATGCAGTGTTTGGTGGG + Intronic
1068919331 10:62465954-62465976 CATCCCATGGGGTGGCTTCTGGG - Intronic
1070129463 10:73646903-73646925 CATCCAGTGTAGTGGCTGCTCGG + Exonic
1070827201 10:79398178-79398200 CATCCCATGCAATGGCGTGTTGG - Intronic
1073639520 10:105236688-105236710 AATGCCATGCAGTGTCTGATAGG + Intronic
1077184395 11:1229819-1229841 CACCCCAGGCGGAGGCTGGTGGG - Intronic
1077184410 11:1229869-1229891 CACCCCAGGCAGAGGCTGGCGGG - Intronic
1080999265 11:37647743-37647765 AATGCCATGAAGTGGTTGGTGGG - Intergenic
1081570838 11:44289854-44289876 CATCTCATGGCGTGGGTGGTTGG + Intronic
1084029378 11:66472265-66472287 CTTCCCAGGGAGTGGCTGCTGGG + Intronic
1084777822 11:71388924-71388946 CAGCCCATGCAGTGGCTCAGAGG - Intergenic
1084795190 11:71500761-71500783 TATCCCCTGCTGTGGCTGGACGG + Intronic
1085260080 11:75199610-75199632 CAACCCTTGAAGTGGCTGGCTGG - Intronic
1089171217 11:116512903-116512925 CATTCCAGGCAGGGGCTTGTGGG + Intergenic
1091387985 12:107236-107258 CATCCCCGGCAGTGGCAGCTGGG + Intronic
1092281983 12:7104530-7104552 CATCCCAAGCTGTGCCTGCTAGG + Intronic
1092287545 12:7137465-7137487 CATCCCATCCTGGGACTGGTTGG + Intronic
1093807025 12:23446858-23446880 CATCCCATCCAGTGGTCCGTTGG - Intergenic
1094498614 12:31004743-31004765 CCTCCCATGCAGTGGAGGGCAGG + Intergenic
1094655935 12:32419506-32419528 CATCCCCAGCAGTGGCTGCGTGG - Intronic
1094830203 12:34296676-34296698 GACCCCATGCAGGGGCTGCTGGG - Intergenic
1094835252 12:34319198-34319220 GGCCCCATGCAGTGGCTGCTGGG + Intergenic
1094837344 12:34328314-34328336 GGCCCCATGCAGTGGCTGCTGGG + Intergenic
1097042439 12:56163851-56163873 CATGGCATGCAGTGGCTGGGTGG + Intronic
1100168208 12:91942462-91942484 AATTCCATACAGTGGCTGATCGG + Intergenic
1101150493 12:101878323-101878345 CATCCCTTGAAGTGGATGTTTGG + Intronic
1101335422 12:103792079-103792101 CGTCCCATGATGGGGCTGGTTGG - Intronic
1102006171 12:109590574-109590596 CATCCCAGGCACTGGTTGGGTGG - Intronic
1102183507 12:110930918-110930940 CAAGCTATGCAGTGGCTGGGTGG - Intergenic
1104402515 12:128488174-128488196 CATGCCATGCAGTGGTAGGCTGG - Intronic
1104808883 12:131608031-131608053 CTTTGCATGCAGTGGCTGGTCGG + Intergenic
1108351826 13:49595014-49595036 CTTGCCATCAAGTGGCTGGTTGG - Intergenic
1110033829 13:70654044-70654066 CTTCCCATGTCCTGGCTGGTTGG + Intergenic
1111897611 13:94160538-94160560 CAACCCATGCAGTGCATGGAAGG - Intronic
1112431744 13:99356145-99356167 CATCCCTTGCAGGGGCTGTTGGG + Intronic
1114316553 14:21515047-21515069 GATTCCATGGAGTGCCTGGTAGG - Intergenic
1116110561 14:40575330-40575352 CATGACATGCAGTGGCAGGACGG + Intergenic
1117139103 14:52768064-52768086 CATACCATGCAAGGGCTTGTTGG + Intronic
1118736454 14:68704814-68704836 CCTGAGATGCAGTGGCTGGTTGG - Intronic
1119582961 14:75804069-75804091 CATCCCGGGCACTGGCTGGTTGG - Intronic
1121534129 14:94679510-94679532 CACCCCAGGCAGTGGCTGTGGGG + Intergenic
1121586317 14:95065363-95065385 CATCAACTGCAGTGGCTGGGTGG + Intergenic
1122371384 14:101230579-101230601 CATCCCATGCAGGGACTTGCAGG + Intergenic
1123826396 15:24086478-24086500 CATCATGTGCAGTGGTTGGTGGG + Intergenic
1124632738 15:31346757-31346779 CATCCCAGGCACTTGGTGGTGGG + Intronic
1125420794 15:39502041-39502063 AATCACGTGCAGGGGCTGGTTGG + Intergenic
1127899508 15:63330598-63330620 CAGCCCAGTCTGTGGCTGGTGGG + Intronic
1130318449 15:82817360-82817382 CAGACCATGCAGGGGCTTGTGGG + Intronic
1130758201 15:86789140-86789162 CATTGCAGGCAGTGGCTTGTAGG - Intronic
1132557328 16:578400-578422 CATCTGCTGCAGTGGCTGATGGG + Exonic
1133572939 16:7059711-7059733 CATCCTATGTAGTGACTGTTTGG + Intronic
1134882507 16:17758011-17758033 CAACCCCTGCAGTGCCTAGTTGG - Intergenic
1138806939 16:60100954-60100976 CATGCCATGCAGCTGCTGCTGGG + Intergenic
1143774019 17:9186080-9186102 CATCCCAGGCAGAGGCCTGTGGG + Intronic
1144729295 17:17517521-17517543 CATCCCACCCAGTGCCTGGCCGG - Intronic
1147325992 17:39669870-39669892 CTTCCCATAGAGTGGCTGGTTGG + Intronic
1148439275 17:47703226-47703248 CAGCCCACGCAGAGGCTTGTGGG - Intronic
1148785948 17:50146311-50146333 CATCGCCTGCAGTGACAGGTTGG + Intronic
1149523460 17:57336054-57336076 TATGCCATGCAGTAACTGGTGGG - Intronic
1149589174 17:57815844-57815866 CAGCAGATGCAGTGCCTGGTGGG + Intergenic
1154250208 18:12738099-12738121 AGTCCCATGCGGTGGCCGGTGGG + Intergenic
1154396366 18:13993749-13993771 CAGCCCATGCAGTAGCTACTGGG + Intergenic
1161063080 19:2224944-2224966 GACCCCATGCAGTGTGTGGTTGG + Intronic
1164485214 19:28650213-28650235 CAGCCTCTGCAGTGGCTGTTGGG - Intergenic
925814308 2:7732701-7732723 CATGCCCTCCAGTGGATGGTGGG + Intergenic
926107584 2:10162087-10162109 CATCCCAGGCAGCGGCGGATGGG - Intronic
926107881 2:10163592-10163614 CATCCCGGGCAGTGGCGGGTGGG + Intronic
927740663 2:25566695-25566717 CATCCCATGCATTGACTATTAGG - Intronic
928091881 2:28379618-28379640 TATACCATTCAGTGGTTGGTAGG + Intergenic
928338985 2:30425127-30425149 CATTACATGCAGTGGGTGCTGGG + Intergenic
929585786 2:43113519-43113541 GATCCCATGCACTGGCTGAATGG - Intergenic
929891555 2:45922629-45922651 CACCCCAGGCAGTTGCTGCTGGG - Intronic
931074597 2:58695694-58695716 CATCTCTTGTAGTGGGTGGTGGG - Intergenic
931092547 2:58901378-58901400 CATCCTTGGCAATGGCTGGTGGG + Intergenic
933860463 2:86461759-86461781 CATCGTTTTCAGTGGCTGGTTGG - Intronic
935410336 2:102755534-102755556 CATACCATGCTGTGCCTGGGTGG - Intronic
936523319 2:113226139-113226161 CACCCTATGCAGAGGCAGGTGGG - Intronic
936903914 2:117514810-117514832 CATCCCAGGCAGTGGGTGGTTGG + Intergenic
937350405 2:121156739-121156761 CATGCCAAGCAGGGGATGGTGGG - Intergenic
938389374 2:130892994-130893016 CATCCTAGGCAGTGGCTTGCAGG + Intronic
939950669 2:148468803-148468825 CATCCTGTGCAATGGCTGGAAGG + Exonic
941708764 2:168689009-168689031 CATCCCTTGCAGTGACAGGCAGG - Intronic
943185409 2:184599727-184599749 GAACCCATGCAGTTGCTGGAAGG + Intronic
945444861 2:209924945-209924967 CTGCCCATCCAGTGGCTGCTAGG + Intronic
946073966 2:217058319-217058341 CTTCCCATGCAGTGGCTTTGGGG + Intergenic
947924359 2:233908177-233908199 CATCACGTGCAGTGGGTTGTTGG + Intergenic
948707500 2:239804268-239804290 CATCACATGCAGTGGCAGTGAGG - Intergenic
1169889945 20:10441486-10441508 CATCCCATGCAGTGGCTGGTGGG + Intronic
1170150127 20:13220369-13220391 CATGCCTTGCAGTGGGCGGTTGG - Intergenic
1170819532 20:19744677-19744699 CATCTCATTCAATGGCTTGTTGG - Intergenic
1173400694 20:42723464-42723486 TATCCCCAGAAGTGGCTGGTGGG + Intronic
1173719803 20:45246321-45246343 CCTCCCGTGCAGGGGCTGCTGGG + Intergenic
1175650219 20:60715387-60715409 GATCCCAGGCAGAGCCTGGTGGG - Intergenic
1175816998 20:61888367-61888389 CCTCCCTTGCAGCGGCTGGACGG - Intronic
1179076784 21:38129644-38129666 CAGCCCATGCAGTGGCAGAGAGG - Intronic
1179609394 21:42540078-42540100 CATCCCAAGATGGGGCTGGTTGG + Intronic
1181558930 22:23688477-23688499 CAGCCCAGGCAGTGCCTGGCAGG + Intronic
949554876 3:5144202-5144224 CATTCCCAGCAGTGGCTGTTGGG + Intronic
950710950 3:14812289-14812311 CTTTCCAAGCAGTGGCTGGCTGG - Intergenic
950980123 3:17294642-17294664 CATTGCATGCAGTGACTGGATGG - Intronic
952513021 3:34076190-34076212 CTTCCCATACAGTGGGTGGCCGG + Intergenic
953328453 3:42032325-42032347 CTTCCCAGGCAGTGGCTGCAAGG + Intronic
953766755 3:45748809-45748831 CATCCCCTGCAGTCCCTGGTTGG - Intergenic
957311808 3:78529871-78529893 CATCCCATGCAGTCTCTCGGTGG - Intergenic
959884088 3:111478956-111478978 CATCATATTCTGTGGCTGGTGGG - Intronic
961364716 3:126391997-126392019 CAACCCATGCAGGGGCTCCTAGG + Intergenic
961741997 3:129038925-129038947 GAGCCCACGCAGTGGCTGGAGGG + Intronic
962448638 3:135492699-135492721 CATCCTCTGCAGGGTCTGGTGGG + Intergenic
967041815 3:185700534-185700556 CATCCCATACAGTGGCTACATGG + Intronic
972428697 4:38959791-38959813 CATGCCACTCATTGGCTGGTGGG + Intergenic
975720696 4:77245990-77246012 CTTCCCATCCAGAGGGTGGTGGG + Intronic
976863444 4:89694517-89694539 CTTCCCATCCAGTGACTGCTAGG - Intergenic
979323290 4:119349543-119349565 CATCACAGAGAGTGGCTGGTGGG + Intergenic
983241119 4:165234181-165234203 CATCACAGAGAGTGGCTGGTGGG + Intronic
983741289 4:171137993-171138015 CTTACCATCAAGTGGCTGGTTGG - Intergenic
984041013 4:174733765-174733787 CATCCCATGCAGGGCCATGTGGG - Intronic
985065690 4:186118820-186118842 CCTCCCAGGCAGTGGGTGCTTGG - Intronic
991966237 5:72094295-72094317 CATCCCATGCTGTTTCTGTTTGG + Intergenic
993571999 5:89552295-89552317 CTTACCATGCAGTGCTTGGTAGG - Intergenic
995240561 5:109881484-109881506 CATCCCATGGAGGGGATTGTGGG + Intergenic
998170815 5:139871073-139871095 CATCCCATGGAGTGGGGGCTAGG + Intronic
999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG + Intergenic
1000407129 5:160899959-160899981 CTTCCCTTGGAGTGGCTGATGGG - Intergenic
1000673426 5:164090644-164090666 CATCCCTTGGGGTGGCTGGAAGG - Intergenic
1001764568 5:174235274-174235296 TGGCCCATGCAGTGGATGGTGGG + Intronic
1002308154 5:178296489-178296511 GATCCCACGCAGGGGCTGCTGGG + Intronic
1003083167 6:3038464-3038486 CACACCATGCAGTAGCTGGGAGG + Intergenic
1004421442 6:15473720-15473742 TATCCCAGGTAGTGGCTTGTGGG - Intronic
1006026240 6:31148823-31148845 AATGCCATGCAGGGGCTGGGGGG + Intronic
1006364500 6:33607460-33607482 CTTCCCCAGCAGTGGCTGGGAGG - Intergenic
1007550708 6:42727713-42727735 CATCATATTCGGTGGCTGGTGGG - Intergenic
1008266150 6:49429011-49429033 CATCACATACAGTGGCCTGTTGG + Intergenic
1009513477 6:64582759-64582781 TATTCCATGCAGTGACTAGTGGG + Intronic
1018847823 6:167567342-167567364 CAGCCCAGGCGGTGGCTGGAGGG + Intergenic
1019442918 7:1056435-1056457 ATTCCCATCCAGAGGCTGGTGGG - Intronic
1019544438 7:1566747-1566769 CGTCCCTCGCAGTGGCTGGAGGG + Intergenic
1019774284 7:2903193-2903215 TGTCCCAGGCAGTGGCTGGCTGG - Intergenic
1022341548 7:29473097-29473119 CATGCCCTGCAGGGGCTTGTGGG - Intronic
1022516545 7:30978304-30978326 CATCCCAGGCTGAGGCTGGTGGG + Intronic
1023685758 7:42733421-42733443 CATACCATGCTGTGGCCGCTAGG - Intergenic
1024910718 7:54444243-54444265 CATCCCAGACAGTGGGCGGTCGG - Intergenic
1025261251 7:57418944-57418966 CATCCCATGGCTTGGCTGTTGGG - Intergenic
1026727396 7:72880032-72880054 CTTCCCATGCAGCGCCTGTTCGG - Intronic
1026982585 7:74535573-74535595 GAGCCCATGCAGTGGCCCGTGGG + Intronic
1027275371 7:76550008-76550030 CTTCCCATGCAGCGCCTGTTCGG - Intergenic
1029721082 7:102364558-102364580 CTTCCCATGCAGCGCCTGTTCGG - Intronic
1033418969 7:141189287-141189309 TTTCCCATGCAGTGGCTGCAGGG + Intronic
1034344701 7:150379229-150379251 CAGCCAATGGAGTGGCTGGGCGG + Intronic
1034739240 7:153457859-153457881 CAGCCCATGGAGAGGCAGGTGGG + Intergenic
1034887017 7:154805836-154805858 CATCCCATGCAGAGGCACGGGGG - Intronic
1035118977 7:156549174-156549196 AATCCCAGGCTGTGGCTTGTTGG - Intergenic
1035967917 8:4215151-4215173 CATCCCAAACAGGGGCTGATAGG + Intronic
1037169053 8:15868090-15868112 CATCCCAGTCAGTGGCTAGCAGG - Intergenic
1037717485 8:21412303-21412325 CTTCCGATGCAGTGACTGGCTGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037835451 8:22212575-22212597 CATTCCATAAAGTGGCTGTTTGG + Intergenic
1037908155 8:22727579-22727601 CATCACCTGCAGGGTCTGGTCGG + Intronic
1040275802 8:46013057-46013079 GATGCCATGCAGGGGCTGCTGGG + Intergenic
1042325979 8:67528328-67528350 GCTTCCATGCAGAGGCTGGTTGG + Intronic
1045504182 8:102767081-102767103 CATCCCACACTCTGGCTGGTGGG + Intergenic
1048150571 8:131889581-131889603 CCTCTCATGAAGTGGCTGGCTGG - Intergenic
1048276033 8:133066859-133066881 GATCCCGTGCAGGGGCTGGGGGG + Intronic
1051122074 9:13762198-13762220 CTTGCCATGGAGAGGCTGGTCGG + Intergenic
1051434531 9:17016880-17016902 CTTCCCATGCACAGGCCGGTTGG + Intergenic
1051966761 9:22837005-22837027 CATGCCATGCAGTGGCTGGTGGG + Intergenic
1053323213 9:37118959-37118981 CATCCCATGTAGGTGGTGGTGGG + Intergenic
1056543226 9:87592264-87592286 CAGCCCATGCTGTGGTTGGGTGG - Intronic
1057695148 9:97317883-97317905 CTTTCCATGCAGTATCTGGTTGG - Intronic
1058672003 9:107367700-107367722 CACCCCATGCAGGGGCTGGCTGG - Intergenic
1059193052 9:112345213-112345235 CCTCCCAAGGAGTAGCTGGTGGG - Intergenic
1059213997 9:112542845-112542867 AATCTCATGCAGTGGCTTGCAGG - Intronic
1059618831 9:115980965-115980987 CATCCCTTGCTTTTGCTGGTTGG + Intergenic
1060198033 9:121635799-121635821 CATCCCCTGCAGGGCCTGGCAGG + Intronic
1061933193 9:133843855-133843877 TGTCCCATGGAGTGGCGGGTTGG + Intronic
1062196797 9:135278756-135278778 CGTGCCATGCAGTCGTTGGTTGG - Intergenic
1192583167 X:72301386-72301408 CATGGCATACAGGGGCTGGTTGG - Intronic
1194007361 X:88512049-88512071 CTTCCCATGCAGTGGTGGCTTGG + Intergenic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1197820364 X:130535274-130535296 CACACCATACAGTGGCTGGAAGG + Intergenic
1198509403 X:137334506-137334528 CATCCCATACAGTGGTTAGAAGG + Intergenic
1200001212 X:153060702-153060724 AGGCCCAGGCAGTGGCTGGTTGG + Intergenic