ID: 1169891857

View in Genome Browser
Species Human (GRCh38)
Location 20:10461973-10461995
Sequence ATGGAGTCTCAGAGCGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169891855_1169891857 19 Left 1169891855 20:10461931-10461953 CCACTCTCGGCTAATTTTTTTTA 0: 1
1: 60
2: 1924
3: 32885
4: 82623
Right 1169891857 20:10461973-10461995 ATGGAGTCTCAGAGCGAAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 205
1169891854_1169891857 22 Left 1169891854 20:10461928-10461950 CCACCACTCTCGGCTAATTTTTT 0: 42
1: 1722
2: 34296
3: 123871
4: 225834
Right 1169891857 20:10461973-10461995 ATGGAGTCTCAGAGCGAAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169891857 Original CRISPR ATGGAGTCTCAGAGCGAAAA AGG Intronic
904824309 1:33264698-33264720 AAGGAGGCCCAGAGAGAAAATGG + Intronic
906659750 1:47573878-47573900 ATGGAGTCTCAGAGAGGGCAAGG + Intergenic
906919060 1:50044042-50044064 ACTGAGGCTCAGAGAGAAAAAGG + Intergenic
907898704 1:58717764-58717786 GTGGATTCTCAGAAAGAAAAAGG + Intergenic
909292467 1:73901374-73901396 ATGGACTTTCAGAGTTAAAATGG + Intergenic
911038440 1:93573502-93573524 ATGGAGACAAAGAGGGAAAATGG - Intronic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
913054720 1:115147768-115147790 ATGGAGACTCAGAGGGTAAGGGG + Intergenic
913113662 1:115677959-115677981 ATGGAATTTCAGAGGCAAAAAGG - Intronic
913393422 1:118340013-118340035 ATTGAGTCTCAGAGCAAAGCAGG - Intergenic
913694188 1:121308324-121308346 ATGGAATTTCAGAGCTAGAAGGG - Intronic
914143375 1:144971742-144971764 ATGGAATTTCAGAGCTAGAAGGG + Intronic
914887069 1:151594194-151594216 ATGGAATTTTAGAGCTAAAAGGG - Intergenic
915122773 1:153641685-153641707 ATAGATTCTCAGAGGAAAAATGG + Intronic
916613663 1:166417809-166417831 ATGGAATCTCAGAACTAAATAGG - Intergenic
919752483 1:201047000-201047022 ATGGAGACATAGAGGGAAAAAGG - Intronic
920481515 1:206326711-206326733 ATGGAATTTCAGAGCTAGAAGGG - Intronic
920885227 1:209921004-209921026 AAGGAGTTTCAGAAAGAAAAAGG - Intergenic
922947267 1:229527461-229527483 ATGAAATTTCAGAGCTAAAAGGG + Intronic
923712416 1:236397780-236397802 ATAGAGTCCCAGAGCGGGAATGG - Intronic
924626806 1:245702414-245702436 ATGGAGACGCAGAGCAAACAGGG - Intronic
1066801394 10:39196062-39196084 ATTGAGGCTTAGAGTGAAAAAGG - Intergenic
1068388685 10:56363680-56363702 GTGGAGTCTCAGAGAGGCAAGGG + Intergenic
1069367590 10:67710495-67710517 GTGGAGCTTCAGAGAGAAAAGGG - Intergenic
1070661483 10:78309589-78309611 GTGGAGTCTCAGAGAGAAAGCGG + Intergenic
1070669239 10:78366554-78366576 ATGGGATCACAGAGAGAAAAGGG - Intergenic
1072189252 10:93066926-93066948 ATGGAGTGTCAGAGCTGGAAAGG - Intronic
1077667209 11:4123244-4123266 ATTGAGTCTCAGACGGAAACAGG + Exonic
1077788057 11:5406132-5406154 ATGCAATCTCAGAAAGAAAATGG - Intronic
1078366192 11:10708343-10708365 ATGGATTCTCAGAGAGAAGGGGG - Intergenic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1080113809 11:28599424-28599446 CTGGAGTCTTAAAGGGAAAATGG + Intergenic
1080955796 11:37094262-37094284 ATGGAGTGTCAGTGCCAAGAAGG - Intergenic
1082062101 11:47869711-47869733 ATGGTGTCCCAGAGGGAAAGTGG + Intergenic
1082303750 11:50545241-50545263 ATTGAGGCTTAGAGTGAAAAAGG - Intergenic
1083783984 11:64933563-64933585 ATGGAGTCACAGAACAAAAATGG + Intronic
1083949001 11:65943530-65943552 ATGGAGTCTGAGAGCAGAAGAGG + Intergenic
1084475520 11:69386516-69386538 ATGGAGGCTCAGAGAGAGAATGG - Intergenic
1087076439 11:94130443-94130465 CTGGAGTCTGAGAGTGAATATGG + Intronic
1087085555 11:94214609-94214631 ATGGACTATCAGAGCTATAAAGG + Intergenic
1088760792 11:112927108-112927130 ATGGGATATCAGAGTGAAAAAGG - Intergenic
1090314108 11:125769890-125769912 ATGGATGCTCAGAGGCAAAATGG + Intergenic
1090612210 11:128481459-128481481 AATGAATCTAAGAGCGAAAAAGG + Intronic
1091467037 12:693818-693840 ATGGAGTTTCAGAGAAAACAGGG + Intergenic
1094078972 12:26511859-26511881 ATGGGGCCTGAGGGCGAAAATGG - Intronic
1095357914 12:41298023-41298045 ATGGAGTCTGAAAGGGATAATGG - Intronic
1096863503 12:54547278-54547300 AAGGAGCCACAGAGTGAAAAAGG + Exonic
1098300740 12:69051867-69051889 TTGGAGACTCAGTGGGAAAAGGG + Intergenic
1100480894 12:94977882-94977904 ATGGAGTATGAGAGGGAACAGGG + Intronic
1101678007 12:106937224-106937246 ATGGAATTTCAGAGCCCAAATGG + Intergenic
1101790010 12:107917916-107917938 ATGGAGGCTGAGAGAAAAAATGG + Intergenic
1101858931 12:108466995-108467017 ATCGAGTCTCAGAGCTAAGTGGG - Intergenic
1102783168 12:115583166-115583188 ACTGAGTCTCAGAGAGGAAAAGG + Intergenic
1105546560 13:21355159-21355181 AGGAAGTCTGAGAGTGAAAAAGG - Intergenic
1105577991 13:21670762-21670784 ATGGAGGGTCAGAGTGAAACTGG - Intergenic
1106214339 13:27681320-27681342 ATGCAGTCTCAGTGTGAGAAAGG + Intergenic
1107405294 13:40106633-40106655 AAGGAGTTTCAGAGGAAAAAAGG + Intergenic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1111659286 13:91189498-91189520 ATGGAGTAACAGAGAGAGAAAGG + Intergenic
1113371627 13:109730436-109730458 ATGGAGTCTGAGAGTGACACGGG - Intergenic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1115430829 14:33316739-33316761 ATGTACTCTTAGAGCTAAAAGGG + Intronic
1116348129 14:43822689-43822711 ATGGATTGGCAGAGCTAAAATGG + Intergenic
1118071368 14:62249878-62249900 ATGAAGTCACAGAGAGAAGATGG - Intergenic
1118772503 14:68951627-68951649 CTGGAGTTTCAGAGCTGAAAGGG - Intronic
1125198636 15:37077953-37077975 ATTTAGTCTCAGAGCAGAAAGGG + Intronic
1127484181 15:59404220-59404242 ATTGATTCTCAGGGCAAAAAAGG + Intronic
1127798166 15:62455733-62455755 ATGGAGTCCCAGAGGCAAAAGGG - Intronic
1127910715 15:63413863-63413885 ATGGAGTTTCAAAAAGAAAATGG + Intergenic
1128519024 15:68363335-68363357 AAGGAGCCTGAGAGGGAAAAGGG + Intronic
1128580081 15:68803602-68803624 ATGGAGTGTCAGAGCCACAGAGG + Intronic
1130108979 15:80949546-80949568 CTGGAATCTCAGAACTAAAAGGG - Exonic
1130834517 15:87636125-87636147 ATGGAGGCTCAGAGCTCCAAAGG + Intergenic
1131847366 15:96502104-96502126 ATTTAGTCCCAGAGAGAAAAAGG + Intergenic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132298711 15:100763458-100763480 ACAGAGTCTCAGAGGAAAAAGGG + Intergenic
1132990731 16:2791526-2791548 ATGGATTCTCACGGCGAAATGGG + Intergenic
1133494392 16:6303252-6303274 AAGATGTCTCAGAACGAAAATGG - Intronic
1133898006 16:9947755-9947777 ATGGAGCCTCAGAGCTAGTAAGG - Intronic
1134656926 16:15954386-15954408 ATGGAGTGTTAGAGTGGAAAGGG + Intronic
1136094820 16:27947862-27947884 ATGGAATGTCAGAGTGCAAAGGG - Intronic
1140728536 16:77835500-77835522 ATGGGATCTCAGAGCTAGAAGGG + Intronic
1144866733 17:18340366-18340388 TTAAAGTCTCAGAGCAAAAATGG + Intronic
1147911546 17:43859026-43859048 ATACAGGCTCAGAGAGAAAAGGG + Intronic
1147924131 17:43936194-43936216 GTGGAGCCTCAGAGGGAAAGGGG + Intergenic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149274161 17:55015571-55015593 ATTAAGTCTGAGAGAGAAAAAGG + Intronic
1151236606 17:72724641-72724663 CTGAAGTCTCAGAGTGGAAAAGG - Intronic
1152293224 17:79452618-79452640 ATGGGGTCACAGAGCGGAGAGGG + Intronic
1152473806 17:80504454-80504476 ATGGATGCACAGAGGGAAAAAGG + Intergenic
1155150902 18:23122128-23122150 ATGGTGTCCCAGAGGGCAAAGGG + Intergenic
1155787985 18:29926116-29926138 ATGGAGTCTTAGAGGCAAGAGGG + Intergenic
1157176699 18:45458524-45458546 ATGATGTCACAGAGAGAAAACGG - Intronic
1159741067 18:72171369-72171391 ATGTAGTATCAGTGAGAAAAGGG + Intergenic
1160077570 18:75693036-75693058 AAGGAGACTCAGAGCCAAAGGGG - Intergenic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1161846168 19:6713075-6713097 AGGGAGGCTCAGAGTGAAAGTGG - Intronic
1162595209 19:11623336-11623358 ATGGGATATCAGAGTGAAAAAGG - Intergenic
1163501671 19:17680036-17680058 GAGGGGTCTCAGAGGGAAAAGGG + Intronic
1164336798 19:24331495-24331517 ATTGAGGCACAGAGTGAAAAAGG + Intergenic
1166602696 19:44112013-44112035 AAGGGGTCTCCGAGCGGAAAAGG + Intergenic
1167428302 19:49440980-49441002 ACGGAGACCCAGAGAGAAAAGGG + Intronic
1167572958 19:50301607-50301629 GTGGAGTCTCAGAGGGAAGGTGG - Intronic
926227484 2:10978640-10978662 ATGGGGTGTCAGAGCCAAAAGGG + Intergenic
929696064 2:44116539-44116561 ATGCAGTCATAGAGGGAAAATGG + Intergenic
930283358 2:49397649-49397671 ATGGAGTCTTAGAGAAAAAGTGG + Intergenic
932291623 2:70584899-70584921 ACTGAGCCTCAGAGAGAAAAGGG - Intergenic
932306804 2:70709626-70709648 ATAGAGTGTCAGAGCTAGAAGGG - Intronic
932529719 2:72516048-72516070 ACCCAGTCTCAGAGAGAAAATGG + Intronic
936671353 2:114660674-114660696 ATTGAATCACAGAGCTAAAAGGG - Intronic
936922161 2:117699945-117699967 ATGGAATCTTAGAGTTAAAAGGG + Intergenic
939040210 2:137179726-137179748 ATGGAATTTCAGAGCACAAAAGG - Intronic
944582307 2:201142399-201142421 ATGCAATTTCAGAGCTAAAATGG + Intronic
945977656 2:216283297-216283319 GTGGAGAATCAGAGGGAAAAGGG - Intronic
946078425 2:217095548-217095570 AAGGAGTCTCAGAGGGAACATGG + Intergenic
946147358 2:217741151-217741173 GTCTAGTCACAGAGCGAAAAGGG - Intronic
946565267 2:220957344-220957366 ATGGAGTTTTATAGTGAAAAAGG + Intergenic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
1169891857 20:10461973-10461995 ATGGAGTCTCAGAGCGAAAAAGG + Intronic
1170382307 20:15774727-15774749 ATCGAGTTTCAGAGAAAAAAAGG + Intronic
1171300058 20:24052265-24052287 AAGGAGGCTCAGAGTAAAAAAGG - Intergenic
1171976383 20:31597303-31597325 ATTGAGCCCCAGAGAGAAAAAGG - Intergenic
1173165540 20:40684753-40684775 ATGGAGTTTCAGAACCCAAATGG - Intergenic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1175939376 20:62531055-62531077 AAGGAGTCACAGAGAGAAAGTGG + Intergenic
1184146983 22:42617548-42617570 AAGGAATCTCAGACCCAAAATGG - Intergenic
1185064460 22:48624004-48624026 ATGGGATCTCAGAAAGAAAAAGG - Intronic
949159086 3:859190-859212 CTGGAGTCCCAGGGGGAAAATGG - Intergenic
949903024 3:8835667-8835689 AGGGAGTCTCACAGGGACAAGGG - Intronic
950186554 3:10949065-10949087 ATGGAGGCTCAGAGAGGAAGAGG - Intergenic
950961155 3:17109320-17109342 ATGAGGTCTGAGAGCCAAAAAGG + Intergenic
953373413 3:42408518-42408540 ATAGGGGCTCAGAGGGAAAATGG - Intronic
956931949 3:74053463-74053485 CTGGAGTCATAGAGAGAAAATGG + Intergenic
958154855 3:89743494-89743516 ATCCAGTCTCAGGGTGAAAATGG + Intergenic
959580765 3:107980191-107980213 AGGGAGTCTCAGAAACAAAAAGG - Intergenic
959850078 3:111074956-111074978 ATAGAATCTCAGAGCCAAATGGG - Intronic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960619972 3:119628051-119628073 GAGGAGACTCAGAGTGAAAATGG - Intronic
961079491 3:124013874-124013896 ATGGAGTCTCTAAGGGAATATGG + Intergenic
964525519 3:157612357-157612379 ATGGCATCCCAGAGGGAAAAAGG + Intronic
964919063 3:161873664-161873686 TTAGTGTCTCAGAGGGAAAAAGG - Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
969166128 4:5315720-5315742 CTGGAGTCTCAGGGCGAAACTGG - Intronic
972911632 4:43823725-43823747 ATGGGGTCTCAGATGGAAATGGG - Intergenic
973209914 4:47604291-47604313 ATGGAGACTGAGAGCCAAAGAGG - Intronic
973710821 4:53628962-53628984 ATGGAGGCTCAGAAGGGAAAGGG + Intronic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
974511380 4:62846207-62846229 ATGGAGCATAAGAGAGAAAATGG + Intergenic
978383117 4:108151801-108151823 ATGGAATCGCAAAGCCAAAATGG - Intronic
979582653 4:122378929-122378951 ATGGAGTCTTTGAGAGCAAATGG - Intergenic
980181298 4:129404619-129404641 ATGCAATCTCAGATCAAAAATGG + Intergenic
980385988 4:132088607-132088629 AGGAAGTCTCAGAGGGAGAAGGG + Intergenic
982306699 4:153939782-153939804 TTTGAGTCTCAGAGCAAGAAGGG + Intergenic
982549211 4:156776078-156776100 AGGGACTCTCAGAGAGAAAGGGG + Intronic
986545741 5:8894872-8894894 GTAGAGGCTCAGAGGGAAAAGGG - Intergenic
989697810 5:44224467-44224489 ATGGTGTCTCATACTGAAAAGGG + Intergenic
995794190 5:115924573-115924595 AATGAGTCTCAGAACAAAAAAGG + Intergenic
996283851 5:121765585-121765607 ATGGACTCTGAAAGTGAAAACGG - Intergenic
999021979 5:148176101-148176123 ATGAAGTATAAGAGAGAAAAAGG - Intergenic
999169883 5:149584504-149584526 ATAGAGCCACAGAGCCAAAAAGG - Intronic
999414899 5:151386555-151386577 ATGGTATCTCAAAGCAAAAATGG - Intergenic
1001551065 5:172602700-172602722 ATGGAGGCTCAGAGAGTGAAGGG - Intergenic
1001621314 5:173087677-173087699 CTGGAGTCTCAAAAAGAAAAAGG + Intronic
1001686851 5:173599759-173599781 ATGGGGTGTCAGAGCCCAAACGG + Intergenic
1002455469 5:179343870-179343892 ATGGAGTGGCAGGGCGAGAAGGG - Exonic
1003405135 6:5821602-5821624 AGAGAGTCTGAGAGTGAAAAAGG + Intergenic
1005434884 6:25798459-25798481 ATGGAGACTCGAAGTGAAAAAGG - Intronic
1007219366 6:40266278-40266300 ATGGAATGTCAGAGCTAGAAAGG - Intergenic
1007572755 6:42905047-42905069 ATGGAGTGTCAGAGGGCAGAGGG + Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1010852252 6:80791921-80791943 ATAGAATCTCAGAGGTAAAAAGG + Intergenic
1015916515 6:138222961-138222983 ATGGAGTCACAGAGTAAACAAGG - Intronic
1015921482 6:138270330-138270352 ATGTTGTCTCAGACAGAAAAGGG + Intronic
1016518221 6:144921009-144921031 AATGAGACTCAGAGGGAAAATGG + Intergenic
1016730229 6:147420658-147420680 ATGCAGTGACAGAGTGAAAAGGG - Intergenic
1017946625 6:159101328-159101350 ATAGAATCACAGAGGGAAAATGG - Intergenic
1021958321 7:25848780-25848802 TTGAAGCCTCAGAGCTAAAATGG + Intergenic
1026734256 7:72939388-72939410 AGGGAGTCCCAGGGAGAAAAGGG + Exonic
1026784587 7:73294294-73294316 AAGGAGTCCCAGGGAGAAAAGGG + Intergenic
1027109483 7:75425634-75425656 AAGGAGTCCCAGGGAGAAAAGGG - Exonic
1027739552 7:81983326-81983348 ATGGATTTTCACAGCAAAAAAGG - Exonic
1031679315 7:124651754-124651776 AAGGGCTCTCATAGCGAAAATGG - Intergenic
1032513645 7:132491477-132491499 AGGGACAGTCAGAGCGAAAACGG + Intronic
1033946010 7:146718449-146718471 TTGGAGTCTAAGTGGGAAAATGG + Intronic
1035043948 7:155951997-155952019 GTGGAGTGTCAGAGCCAAAAGGG + Intergenic
1035570333 8:668445-668467 ATAGAGTCCCAGAGAGAAACAGG - Intronic
1036768383 8:11563212-11563234 AGTGAGTCCCAGAGCGAAGACGG + Intronic
1038109569 8:24480444-24480466 ATGGAATCTCTGAGTTAAAAGGG - Intronic
1042148397 8:65756347-65756369 CTGGAGTCCCAGAAAGAAAAAGG - Intronic
1043765759 8:84130128-84130150 GTGGAGTCTGAGAGAGAAAGAGG - Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1047165579 8:122434579-122434601 ATGCAGTCTAAGAGAGAGAACGG + Intergenic
1047197243 8:122732854-122732876 AAGGAGTCTGAGAGAGAGAATGG - Intergenic
1051050052 9:12921832-12921854 ATGGGGTCTCACAGCGGAAGGGG + Intergenic
1054741823 9:68813842-68813864 ATCGAGTCTCAGAGGGAGCATGG + Intronic
1055257420 9:74387682-74387704 CTTGAGTCACAGAGCAAAAAAGG + Intergenic
1056208303 9:84340997-84341019 ATGGAGTCTCAAAAAAAAAAAGG + Intergenic
1057307524 9:93920844-93920866 ATGGAGGCAGAGAGAGAAAAAGG - Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1059391945 9:114004734-114004756 ATGGAGTCATGGAGCCAAAAGGG + Intronic
1059556377 9:115284705-115284727 ATGGAGTCTCTGAGTCATAAAGG + Intronic
1059886130 9:118746673-118746695 ATGTAGCCTCACAGAGAAAAAGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060709355 9:125842318-125842340 ATTGAGTGTCAGAGCCAGAATGG - Intronic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195602132 X:106761711-106761733 AGGGAGTGTCAGAGCAAATATGG - Intronic
1195822861 X:108965941-108965963 ATGAAGTATCAGAGCTAAATGGG + Intergenic
1197053375 X:122088259-122088281 GTGGAGTCTCAGAAGGAAAAGGG - Intergenic
1197278286 X:124505386-124505408 ATAGACTCTCAGAGGGGAAAGGG + Intronic
1198873128 X:141196552-141196574 ATGGGATATCAGAGAGAAAAAGG - Intergenic
1200692727 Y:6323336-6323358 ATGGATTCTCAGAACAAATAAGG - Intergenic
1201042546 Y:9851390-9851412 ATGGATTCTCAGAACAAATAAGG + Intergenic
1201325506 Y:12752904-12752926 AAAGAGTCTCAGAACAAAAATGG - Intronic