ID: 1169892906

View in Genome Browser
Species Human (GRCh38)
Location 20:10472802-10472824
Sequence CCTTCTTTGTTACCTGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169892898_1169892906 7 Left 1169892898 20:10472772-10472794 CCCAGAAGGTGTTAGCACCCATC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1169892906 20:10472802-10472824 CCTTCTTTGTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 12
4: 173
1169892899_1169892906 6 Left 1169892899 20:10472773-10472795 CCAGAAGGTGTTAGCACCCATCC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1169892906 20:10472802-10472824 CCTTCTTTGTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 12
4: 173
1169892900_1169892906 -10 Left 1169892900 20:10472789-10472811 CCCATCCCTTTTCCCTTCTTTGT 0: 1
1: 0
2: 11
3: 98
4: 1032
Right 1169892906 20:10472802-10472824 CCTTCTTTGTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 12
4: 173
1169892896_1169892906 29 Left 1169892896 20:10472750-10472772 CCATCTTAGCACAGAGTCACGAC 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1169892906 20:10472802-10472824 CCTTCTTTGTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169892906 Original CRISPR CCTTCTTTGTTACCTGATAC AGG Intronic
900286043 1:1901098-1901120 CCTTCTTTCTTTCTTGAGACAGG - Intergenic
904674705 1:32191806-32191828 CCTTCTCTCTCACCTGACACAGG + Intronic
904808724 1:33149768-33149790 CTTTATTTGTGCCCTGATACTGG + Intronic
908068851 1:60436358-60436380 CCTTCTTTCTCGCCTGTTACAGG + Intergenic
909679824 1:78279125-78279147 ACTTCTATGTAACCTGATTCAGG + Intergenic
910712872 1:90199886-90199908 TGTTCTTTGTTACCTGTTAGAGG + Intergenic
911490230 1:98555764-98555786 CCTTCTTTTATTCCTGATACGGG - Intergenic
915144120 1:153784566-153784588 CCATCTTTGGTCCCTGCTACTGG - Intergenic
918190610 1:182170513-182170535 CCCTCTATGCTACCTCATACAGG + Intergenic
922901872 1:229143554-229143576 CCTTCTGTGTCACCTAATAATGG - Intergenic
922978756 1:229806849-229806871 CCTTCCTTGTTAACTTATACTGG - Intergenic
923653274 1:235893367-235893389 CCTTCTTTGAGACATGATTCAGG - Intergenic
924349735 1:243103383-243103405 CCTTCTATGTTACTATATACAGG - Intergenic
924417608 1:243874064-243874086 CCTTCTTTCATTCCCGATACTGG + Intergenic
1064691892 10:17927036-17927058 ACTCCTGTCTTACCTGATACAGG - Intergenic
1068829567 10:61478038-61478060 CCTTCCTTGTTTCTTGAGACAGG - Intergenic
1071893589 10:90040206-90040228 CCATCTCTGTTACCTGAACCAGG + Intergenic
1074070097 10:110059071-110059093 CCTTGTCTGTTAGCTGACACAGG + Intronic
1075681209 10:124333760-124333782 CCTTCTTTCATTCCTGATATGGG - Intergenic
1076757988 10:132584605-132584627 CCCTCTTTGATTCCTGATAGTGG + Intronic
1079978681 11:27125336-27125358 CATTCTTTGTTATTTGAAACAGG - Intronic
1082066155 11:47902235-47902257 TCATCTCTGTTACCTGAAACTGG + Intergenic
1082947127 11:58772416-58772438 CCTTCTTTGTCTCCTGATCTTGG - Intergenic
1084196948 11:67528422-67528444 CCGTCTTTTTTACCTTATCCTGG - Intergenic
1085691964 11:78671395-78671417 CCTGCTTTGTTTCCTGACCCTGG - Intronic
1090281080 11:125456310-125456332 CCTCCTTTGTTTCCTGAGAGGGG - Intronic
1090687892 11:129144599-129144621 CCTTCTTTGATTCCTGTTTCTGG - Intronic
1094135568 12:27121751-27121773 TCTTCTTTATTAACTGATATAGG + Intergenic
1094185059 12:27633163-27633185 TCTTCTTTATTAACTGATACAGG + Intronic
1095235326 12:39788326-39788348 CCTTATTTGTTACTTAATAATGG - Intronic
1098947974 12:76609206-76609228 CCTTCTTTCTCACCTGACTCTGG + Intergenic
1100684292 12:96969386-96969408 CCTTCTGTGGAACCTGAGACTGG - Intergenic
1101244445 12:102872257-102872279 CCATCTTTGTGACCTTATTCTGG + Intronic
1107088299 13:36448916-36448938 CATTTTTTTTTACCTGAGACTGG - Intergenic
1107298143 13:38936209-38936231 CCTTGTTTTCTCCCTGATACAGG - Intergenic
1108918090 13:55641300-55641322 CTTTCTTTGTTACCTAAATCAGG + Intergenic
1110680717 13:78308953-78308975 CCTTCTTTTCTACCTGAAAGGGG + Intergenic
1111181281 13:84669219-84669241 CTTTCTTTGTTACCTTATGATGG - Intergenic
1111464532 13:88592037-88592059 CCAGCTTTGTTACCTGGAACTGG + Intergenic
1113443155 13:110345595-110345617 CGTTCTTTTTAACCTGATATGGG + Intronic
1113735020 13:112672386-112672408 CCTTCTTCGGCACCTGATACGGG - Intronic
1114911486 14:27204485-27204507 CCTTCTATCTTACCTTATCCTGG + Intergenic
1118405694 14:65421619-65421641 CCTTCTACATTACCTGGTACTGG + Intronic
1119365362 14:74086647-74086669 CCTTCTTTTTTTTCTGAGACGGG - Intronic
1119707391 14:76791924-76791946 CCTTCTTTCTTTCCTGATATTGG - Intronic
1121369991 14:93347653-93347675 CCTTCGTTGTTACCCTTTACCGG + Intronic
1127227275 15:56945241-56945263 TCTTCTTTTCTGCCTGATACTGG + Intronic
1128406631 15:67347319-67347341 TCTTCTTTTGTTCCTGATACTGG - Intronic
1131784391 15:95896213-95896235 TCTTCTTTATTATCTTATACTGG - Intergenic
1131918587 15:97298259-97298281 CCTTCTTTGTTTCCTGTAACAGG + Intergenic
1133181983 16:4063376-4063398 TCTTTTTTTTTTCCTGATACAGG - Intronic
1133640039 16:7707903-7707925 CCTTCCTTGAAAGCTGATACTGG - Intronic
1136225806 16:28859700-28859722 CTTTTTTTTTTTCCTGATACAGG - Intronic
1137068504 16:35876849-35876871 CCTTGTTTCTTTCCTGATATTGG + Intergenic
1140103799 16:71940841-71940863 CCTTTTTTTTTTCTTGATACAGG + Intronic
1140900518 16:79363043-79363065 CTTTCTTTATCACCTGATATGGG + Intergenic
1141018581 16:80473315-80473337 CCATGTTTGTTACCTGAATCAGG - Intergenic
1143278720 17:5734022-5734044 CGTTGTTTGCTACCTGATAAAGG - Intergenic
1143897046 17:10144478-10144500 GATCCTTTCTTACCTGATACTGG - Intronic
1145779045 17:27550043-27550065 CCTTCTTTTTTACCCGAGACAGG + Intronic
1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG + Intronic
1149099403 17:52885441-52885463 TCTACTTTGTGATCTGATACGGG + Intronic
1151141547 17:71997426-71997448 CCTTGTTGCTTACTTGATACTGG - Intergenic
1151443597 17:74149357-74149379 TCTTTTTTGTTTTCTGATACAGG - Intergenic
1151899417 17:77001980-77002002 CCATCTCTGATAACTGATACTGG - Intergenic
1153146509 18:2039012-2039034 CCTTCTATCTTACCTGGCACTGG - Intergenic
1153566478 18:6423387-6423409 CCTTCTTTTGTACATTATACTGG - Intergenic
1155843738 18:30679240-30679262 CCTTCTTTGTGTCTTGATTCTGG - Intergenic
1156813435 18:41279775-41279797 CCTACTTTGTTACTTGTTAATGG - Intergenic
1158175097 18:54646885-54646907 CCTTCTTTATCACTTGATATTGG - Intergenic
1158224213 18:55183763-55183785 CCTTCATTTTTATCTTATACTGG - Intergenic
1161635137 19:5383786-5383808 CCTTCTTTTTTACTTGAGATGGG + Intergenic
1164872527 19:31657865-31657887 CCTTCTTTCATACTTGAAACTGG - Intergenic
924997714 2:378708-378730 ACTTGTTTGTGACCTAATACAGG - Intergenic
925674806 2:6350883-6350905 CCTACTTAGTTACCTGTGACTGG - Intergenic
927275584 2:21259732-21259754 CCTTCTCTGTTCCCTGACCCTGG + Intergenic
927954328 2:27198086-27198108 CCTTATTTGTTTCCTGGTTCAGG - Intergenic
934044359 2:88160157-88160179 CCTTCTTTCCTACATGGTACTGG - Intergenic
935546033 2:104400266-104400288 CTTTTTTTTTTACCTGAGACGGG + Intergenic
935573931 2:104689685-104689707 CCTCCTTTATAACCAGATACTGG + Intergenic
936846952 2:116846969-116846991 ACTTCTTTTTTACCTTACACTGG + Intergenic
939718784 2:145620838-145620860 GCTTATGTGTTACCTTATACAGG - Intergenic
940252353 2:151692962-151692984 CCTTCTTTGTTTTTTGAGACAGG - Intronic
940985204 2:160045665-160045687 GCTGCTTTGTGATCTGATACGGG + Intronic
941117894 2:161492838-161492860 CCTTATTTGTTACCTGAGGTAGG + Intronic
942187384 2:173437358-173437380 CCTTCTTTGGAACCTTCTACAGG + Intergenic
943559075 2:189439885-189439907 GGTACTTTGTAACCTGATACAGG - Intergenic
943898401 2:193399510-193399532 CTTTCTTTGTTGGCTGAAACAGG - Intergenic
944405177 2:199375940-199375962 CATTCTTTTTTACTTTATACAGG + Intronic
944763871 2:202844587-202844609 CCTTCTTTCTTCTCTCATACAGG - Intronic
945134256 2:206609576-206609598 ACTTATTTGATACATGATACTGG + Intronic
946068818 2:217013404-217013426 CTTTCTATGTTCCCTGATCCAGG + Intergenic
947600613 2:231446821-231446843 CCTTCTTTCATTCCTGATAATGG + Intergenic
1169152747 20:3303498-3303520 CATTCTTTCTTCCCTGATATTGG + Intronic
1169892906 20:10472802-10472824 CCTTCTTTGTTACCTGATACAGG + Intronic
1170321793 20:15108119-15108141 CCTTCTTAGCTATGTGATACTGG + Intronic
1170771629 20:19337960-19337982 CCATCTTTGTGACTTGATATGGG - Intronic
1171264979 20:23763803-23763825 CCTTCTTGGTCACCTCATCCAGG + Intergenic
1173154003 20:40592542-40592564 CCTTCTGTGTTCCCTGTTTCAGG - Intergenic
1174861325 20:54094209-54094231 GCTTGTTTGTTTCCTGATATGGG + Intergenic
1176227926 20:64013450-64013472 CCTTCTTTCTTTCTTGAGACAGG + Intronic
1182052300 22:27322853-27322875 TCTTCTTTGTTTTCTGATGCTGG - Intergenic
954728553 3:52637625-52637647 CCTTCTTTTTTTCTTGAGACTGG - Intronic
957216494 3:77326964-77326986 CCTTTTGTGTTAACTGATACAGG + Intronic
961724164 3:128915106-128915128 CCTTGCCTGTTACCTGTTACAGG + Exonic
961953062 3:130770762-130770784 TCATCTTTGTCACCTGAAACTGG - Intergenic
962637479 3:137345947-137345969 ACTTCTCTGTGACCTGAAACAGG - Intergenic
964128131 3:153258100-153258122 CATTCTTTCTTACCAGATTCTGG + Intergenic
966254761 3:177905156-177905178 CCTTAATTGTTGCCTGTTACAGG + Intergenic
966328540 3:178784322-178784344 CCTTCTTTGCTATATGACACGGG - Intronic
967636319 3:191806200-191806222 TCTCCTTTGTTCCCAGATACAGG + Intergenic
968335955 3:197913798-197913820 CCTCCTTTGTTAGCTGAGAGGGG + Intronic
971495687 4:27262763-27262785 CCTTTTTTTTTTCCTGATCCTGG + Intergenic
972582037 4:40403604-40403626 CCTACTGTGTTACCTGCTATAGG + Intergenic
975981506 4:80165763-80165785 TCTTCTTTTATTCCTGATACTGG + Intergenic
977902664 4:102440136-102440158 GCTTCTTTCTTACCAGATAAAGG - Intergenic
979252204 4:118577177-118577199 CCTTCTATGTTACTATATACAGG + Intergenic
979619361 4:122781447-122781469 CCTTTTTTTTTTCCTGATAATGG - Intergenic
980508324 4:133752730-133752752 CCTTCTTTTGTATCTGATATTGG + Intergenic
984013552 4:174400554-174400576 GATTCTTTGATACCTGATGCAGG - Intergenic
984115739 4:175679088-175679110 ATTTCTTTCTTGCCTGATACCGG + Intronic
984932106 4:184857220-184857242 TCTTCTTTGTTACCTGAGGAGGG - Intergenic
986148527 5:5104566-5104588 CCTTATCTGCTACCTGATTCTGG - Intergenic
986406256 5:7427773-7427795 CCTTCCTTGGTACTTGTTACTGG - Intronic
987588151 5:19886147-19886169 CAATCTTTATTACTTGATACTGG + Intronic
989117769 5:37972465-37972487 CCTTCTTCCGTCCCTGATACTGG + Intergenic
989589097 5:43096660-43096682 CATCCTTTGTCACCTGAAACAGG - Intronic
991288213 5:65004698-65004720 CTTTATTTGTTATCTGTTACTGG + Intronic
993521629 5:88909778-88909800 CCTTGTTTCTTACCTGTTAATGG + Intergenic
993811239 5:92479187-92479209 CCTTCTTTGTTTCCTGTAACAGG - Intergenic
995859085 5:116623053-116623075 CCTTCTTTTCTAGCTGACACTGG - Intergenic
999477067 5:151910202-151910224 CTTTCTTTCCTACCTGGTACAGG + Intronic
1001354985 5:171010697-171010719 CCCTCTTTCATTCCTGATACTGG - Intronic
1003638140 6:7853521-7853543 CCTTTTTAGATACCTGAGACGGG + Intronic
1004526942 6:16417834-16417856 CCTTCTTTGGTACCTGGTCATGG - Intronic
1005113071 6:22307213-22307235 CCATGTTTGTTAGTTGATACTGG + Intergenic
1011391503 6:86858851-86858873 CCTTTGTTTTTACCTGATCCTGG - Intergenic
1013663491 6:112322958-112322980 TCTGCTTTCTTACCTCATACAGG + Intergenic
1013740885 6:113283212-113283234 CCTTCTTTCATACCTGATCTTGG + Intergenic
1016557663 6:145357731-145357753 TTTTCTTTGTGCCCTGATACAGG - Intergenic
1016889796 6:148994683-148994705 CCTACTTTGTTTCCTCATAAAGG + Intronic
1018517247 6:164597821-164597843 CCTTCTTTGTTATCTTTTTCAGG - Intergenic
1018706866 6:166469844-166469866 CCTTCTTTGTGACCATAGACTGG - Exonic
1021038514 7:15831438-15831460 CCTTCTTTGTAACTTGGGACAGG - Intergenic
1021438897 7:20655111-20655133 CCTTCTTTCATTCCTGATACTGG - Intronic
1021594352 7:22298948-22298970 CCTTCTTTTATTCCTGATATTGG + Intronic
1024213650 7:47228157-47228179 ACTCCTTTGTGACCTGACACAGG - Intergenic
1030014928 7:105209530-105209552 CTTTCTTTTTTTCCTGAGACAGG - Intronic
1030593827 7:111511890-111511912 ACCTCTTTGACACCTGATACGGG - Intronic
1030644119 7:112040261-112040283 CCTTCTTATTTAAGTGATACAGG + Intronic
1035077867 7:156192922-156192944 CCTTCTTTTATTCCTGATCCTGG + Intergenic
1036161789 8:6395836-6395858 CCTTCTATGTGACCTTATAAGGG + Intergenic
1037288557 8:17326546-17326568 ACTGCTTTGTAACGTGATACTGG + Intronic
1038299255 8:26327002-26327024 CCTTCTTTGTAACTTGTTCCTGG - Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1041332926 8:56747973-56747995 CCTGCTGTGTGACCTGGTACTGG - Intergenic
1041811558 8:61916150-61916172 GCTTCTTTGTTACTTTATATGGG + Intergenic
1041945097 8:63432038-63432060 CCTTCTGTGCTACCTGGTATTGG + Intergenic
1042513985 8:69640798-69640820 CCATCTTTATTTCCTGATATAGG - Exonic
1043041444 8:75267623-75267645 CCTTCTTTGTTACTTTTTAGAGG + Intergenic
1046002625 8:108439991-108440013 CTATCTTTGTTACCTGCTAGTGG + Intergenic
1047626065 8:126657328-126657350 CCTTCTTTGTTTCCTTTTACTGG + Intergenic
1048137169 8:131757764-131757786 TCTTCTTTGTTCCCTGTAACAGG - Intergenic
1050985012 9:12071306-12071328 CCTTCCTTTTTTCCTGATATTGG + Intergenic
1051209987 9:14731171-14731193 CCTTCTGTTGTACCTGATGCTGG + Intergenic
1055134299 9:72809345-72809367 CCTTCTCTGTGACCTAAAACAGG - Intronic
1056846679 9:90044258-90044280 CCTTCTTTTTTCCATCATACAGG - Intergenic
1058042634 9:100320398-100320420 CTTTCTTTGTTACCTGAATTAGG - Exonic
1059134214 9:111788495-111788517 GGTTCTGTGTTATCTGATACAGG - Intronic
1059571050 9:115436169-115436191 CCTTCTTTGTAACCAGAGTCAGG + Intergenic
1061590485 9:131594598-131594620 CTTGCTTTGTTACCTGCCACAGG + Intronic
1186361823 X:8850328-8850350 CCCTTTTTGTTACCTGAGGCAGG + Intergenic
1188856038 X:35197129-35197151 CCTTCTTTGTTCTCTGACAGGGG - Intergenic
1189198231 X:39169440-39169462 CCTTTTTTTTTTCCTGAAACAGG - Intergenic
1189453897 X:41166071-41166093 CCTTCTCTGTTAACTGAAAATGG + Exonic
1190000137 X:46678102-46678124 CCTTCTTTTATTCCTAATACAGG + Intronic
1190424509 X:50320427-50320449 CCCTCTTTCATTCCTGATACTGG + Intronic
1191182537 X:57578589-57578611 CATTCTGTGATACCTGTTACTGG + Intergenic
1193746389 X:85287385-85287407 CCTTCTTTCTTTCTTGATATTGG - Intronic
1193797475 X:85893680-85893702 CCTTCTGTGTGTCCTCATACAGG - Intronic
1193989953 X:88294561-88294583 CCTTCTTTATTTCATGCTACAGG - Intergenic
1195958925 X:110364918-110364940 TCTTCCTTGTGACCTGATGCAGG - Intronic
1196352187 X:114744839-114744861 ACTTCTTTAATAACTGATACTGG - Intronic
1197092872 X:122559315-122559337 CCTTCTCTGGTACCTGGTTCTGG - Intergenic
1197997389 X:132392691-132392713 TCTTCTTTGTTTCCTTACACAGG + Intronic
1198694241 X:139318917-139318939 TCTTCTTTCTGACCTGACACTGG - Intergenic