ID: 1169899799

View in Genome Browser
Species Human (GRCh38)
Location 20:10541323-10541345
Sequence TGGGATTCCCCTTGCATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169899794_1169899799 -1 Left 1169899794 20:10541301-10541323 CCTTCTGGAATTCCCTGCAGGAT 0: 1
1: 0
2: 5
3: 19
4: 210
Right 1169899799 20:10541323-10541345 TGGGATTCCCCTTGCATCACTGG 0: 1
1: 0
2: 1
3: 8
4: 98
1169899792_1169899799 8 Left 1169899792 20:10541292-10541314 CCTTAGGAGCCTTCTGGAATTCC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1169899799 20:10541323-10541345 TGGGATTCCCCTTGCATCACTGG 0: 1
1: 0
2: 1
3: 8
4: 98
1169899790_1169899799 21 Left 1169899790 20:10541279-10541301 CCTCACATGTGGTCCTTAGGAGC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1169899799 20:10541323-10541345 TGGGATTCCCCTTGCATCACTGG 0: 1
1: 0
2: 1
3: 8
4: 98
1169899789_1169899799 22 Left 1169899789 20:10541278-10541300 CCCTCACATGTGGTCCTTAGGAG 0: 1
1: 0
2: 2
3: 5
4: 93
Right 1169899799 20:10541323-10541345 TGGGATTCCCCTTGCATCACTGG 0: 1
1: 0
2: 1
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169899799 Original CRISPR TGGGATTCCCCTTGCATCAC TGG Intronic
902478924 1:16701615-16701637 TGGCTTTCCCCTTTCATCTCTGG - Intergenic
903669484 1:25027090-25027112 TGGGATTCCCCTCGCCTGATCGG - Intergenic
907233701 1:53025233-53025255 TGGTTTTCCTCTTGCATCACTGG + Intronic
909160420 1:72141220-72141242 TGTGTTTCCCCTTGCATCTTTGG - Intronic
911991446 1:104702893-104702915 TTGAATCACCCTTGCATCACTGG - Intergenic
912630578 1:111243288-111243310 TGGGATTCCCCTTGCCAGGCTGG + Exonic
912809529 1:112783303-112783325 TGGGAAGCCCCTCCCATCACAGG - Intergenic
916568835 1:166007849-166007871 TGAGCTCCCCCTTGCATCTCTGG + Intergenic
921742005 1:218695859-218695881 TGTGATTCCTCTTCCATCTCTGG + Intergenic
924042148 1:239994224-239994246 TGTGATTTCCCTTCCACCACTGG - Intergenic
1063767576 10:9160399-9160421 AAGGCTTCCCCTTCCATCACAGG + Intergenic
1063767825 10:9162489-9162511 GAGGCTTCCCCTTCCATCACAGG + Intergenic
1064236454 10:13580646-13580668 TGGGATGCCCCTTGAAGCAGTGG + Intergenic
1067946544 10:50692831-50692853 TGGTCCTTCCCTTGCATCACTGG - Intergenic
1070881856 10:79857832-79857854 TGGTCCTTCCCTTGCATCACTGG - Intergenic
1071648436 10:87374146-87374168 TGGTCCTTCCCTTGCATCACTGG - Intergenic
1073452746 10:103619301-103619323 TGGGATTTGCCATGCCTCACTGG - Intronic
1075666808 10:124236995-124237017 TGGCATTCCATTTGCATCCCAGG + Intergenic
1076579179 10:131495463-131495485 TGGGATTCCCCTGGATTCTCTGG + Intergenic
1077120851 11:907749-907771 TGGCCTTCCCCTTGGGTCACAGG + Intronic
1082782297 11:57297438-57297460 GGGGCTGCCCCTTCCATCACAGG + Intergenic
1083236936 11:61357028-61357050 TGGGATTCCTCTCCCCTCACAGG + Intronic
1086589125 11:88491077-88491099 TGGAATTACCCTTGCATCCCTGG - Intergenic
1090743042 11:129683617-129683639 TGGGAGCCCCCTTGCATTGCTGG - Intergenic
1091028773 11:132164936-132164958 TGAGTTTCCCCTTGCCTCCCTGG + Intronic
1091234656 11:134013050-134013072 TGCAGTTCCCCTTGCACCACTGG - Intergenic
1094090466 12:26644108-26644130 AGGGATGCCCCTCCCATCACAGG + Intronic
1097221606 12:57454627-57454649 TGGGCTTCCCCAGACATCACAGG + Intronic
1101155421 12:101923167-101923189 GGGGATCCCCCTTGTAACACTGG + Exonic
1108446139 13:50510803-50510825 TGGCTTTCCCCTTACCTCACTGG - Intronic
1115106783 14:29771284-29771306 TGGGCTGCCCCTCTCATCACAGG + Intronic
1117778564 14:59208232-59208254 TGGGAGTCCCCTTGGACAACAGG - Intronic
1122386354 14:101350935-101350957 TGGGAATCCACTTGCACCTCCGG + Intergenic
1124599034 15:31116185-31116207 TGGTATTTCCCTTCCAACACTGG - Intronic
1132303004 15:100788032-100788054 TGGGAATCTCCTGCCATCACAGG - Intergenic
1139563052 16:67755955-67755977 TTGGTTTCTCCTTGCATCACTGG - Intronic
1144884239 17:18448095-18448117 TTGGATTCCCCTTGGAGCAGGGG + Intergenic
1147161092 17:38569779-38569801 TGGGCATCCCCTAGCACCACTGG - Intronic
1150274122 17:63884978-63885000 TGGGATTCCCCTGACAGTACTGG + Intergenic
1150276278 17:63899783-63899805 TGGGATTCCCCTGACAGTACTGG + Intergenic
1152234516 17:79131760-79131782 AGGGAGGCCCCTGGCATCACTGG - Intronic
1160236322 18:77089014-77089036 TGGTGCTCACCTTGCATCACAGG + Intronic
1161449845 19:4338905-4338927 GGGGATTTCCCTAGGATCACTGG - Intronic
1163269464 19:16242412-16242434 TGGGACACCCCTAGCATCTCTGG + Intronic
1202712965 1_KI270714v1_random:27522-27544 TGGCTTTCCCCTTTCATCTCTGG - Intergenic
926391557 2:12399321-12399343 TGGGACTCCAGTTCCATCACTGG - Intergenic
932542078 2:72665189-72665211 GGGGAGCCCCCTTCCATCACTGG - Intronic
933070849 2:77856864-77856886 TGGCATGTCCCTTCCATCACAGG + Intergenic
941705461 2:168654052-168654074 TGAGATTCCTCATGCATCTCAGG + Intronic
944213165 2:197227387-197227409 TGGGTGTCCCATTGCATCGCTGG + Intronic
945989056 2:216378272-216378294 TGGGATTCCCCTTCCATGTTTGG - Intergenic
948480386 2:238246393-238246415 ATGGATCCCCCTTGAATCACAGG - Exonic
1169899799 20:10541323-10541345 TGGGATTCCCCTTGCATCACTGG + Intronic
1174442761 20:50569199-50569221 TGCGGTTCCCTTTGCCTCACAGG + Intronic
1175158671 20:56991865-56991887 TGGGATTCACCTTGCAGCCAGGG - Intergenic
1179373333 21:40827118-40827140 TGGGTTTCCCTCTGCCTCACTGG - Intronic
1182538046 22:31020578-31020600 AAGGCTGCCCCTTGCATCACTGG - Intergenic
1184818954 22:46894167-46894189 TGGGCTTGGCCTGGCATCACAGG - Intronic
950057601 3:10039796-10039818 TGGGAATCCCCTAGGATCTCAGG - Exonic
952744000 3:36761231-36761253 TGGGCTTCCCCTATAATCACTGG + Intergenic
959928859 3:111956370-111956392 TGGGATTCCCATTACTTCAGGGG - Intronic
961739682 3:129025323-129025345 TGGGATTCCTCCTGCCTCCCTGG - Intronic
969464460 4:7347476-7347498 TGGGAGTCCCTATGCCTCACTGG - Intronic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975650268 4:76586127-76586149 TGGACTTCCCCTTACATCAGCGG + Intronic
975716594 4:77210980-77211002 TGCATTTCCCCTTGCCTCACTGG - Intronic
977350122 4:95873764-95873786 TGGATTTCACATTGCATCACTGG + Intergenic
984943796 4:184955530-184955552 AGGGGTTCCCCTGGAATCACTGG + Intergenic
985067194 4:186134088-186134110 TGGGAATCCTCGTGCATCACCGG - Intronic
985627941 5:999770-999792 TGGGATTCTCCTGGCAACAGGGG - Intergenic
987478862 5:18428238-18428260 TGGGCATCCCCTCCCATCACAGG + Intergenic
988458883 5:31414156-31414178 TGGGATTCCCCTTCCCCTACAGG - Intronic
993982091 5:94554885-94554907 TGGGATTCCTATTGCTTCAAGGG + Intronic
994592719 5:101791997-101792019 CAGGCTTCCCCTTTCATCACAGG - Intergenic
995429064 5:112054571-112054593 AGGGAAGCCCCTTCCATCACAGG + Intergenic
999755920 5:154664152-154664174 TGGAAAGCCCCTTCCATCACAGG - Intergenic
1002060089 5:176620833-176620855 TGATATTCCTCCTGCATCACCGG + Exonic
1003252672 6:4444754-4444776 TTGGATTCCTCATACATCACTGG - Intergenic
1005836140 6:29710960-29710982 TGGAATTCCCACTGCATCATAGG - Intergenic
1005856911 6:29869716-29869738 TGGGATTCCCGTGGCATCATAGG - Intergenic
1009448931 6:63778796-63778818 TGGGATACCCCTTTCTTCACAGG + Intronic
1010712694 6:79193652-79193674 TGTGATTACTCTTGCAACACAGG + Intergenic
1013167326 6:107605811-107605833 TGGGATTCTCCATGCTTAACAGG - Intronic
1016154570 6:140788481-140788503 TTGAATCCTCCTTGCATCACTGG + Intergenic
1016686009 6:146883095-146883117 TGGGATGCCCCTTGGAGAACAGG + Intergenic
1017496574 6:154988907-154988929 TGCTCTTCCCCTTCCATCACAGG + Intronic
1017751171 6:157491856-157491878 TAGGATTACGCTTGCATCGCTGG - Intronic
1022541635 7:31141967-31141989 TGGAATTATCCTTGCATCCCTGG + Intergenic
1023968283 7:44974849-44974871 TGGGCTTCCCCTGGGATTACAGG - Intronic
1024329468 7:48141635-48141657 TGCTATTCCCCTTGCAGAACAGG + Intergenic
1027967021 7:85025344-85025366 TGGGTTTCCACTTTCATCTCAGG - Intronic
1028442159 7:90876210-90876232 TGGGAATCTCATAGCATCACAGG - Intronic
1034965561 7:155388655-155388677 TGGGCTTTCCCTTGCAGGACTGG + Intronic
1035113417 7:156504054-156504076 TGGGATTCTCCTTCCAGCTCAGG - Intergenic
1038532479 8:28329504-28329526 TGGGAATGACCTGGCATCACAGG - Intronic
1042678072 8:71345209-71345231 TGGCATTGCCCCTTCATCACAGG - Intronic
1046272805 8:111917803-111917825 AGGGCTGCCCCTTCCATCACAGG - Intergenic
1047926978 8:129691604-129691626 TGGGATTCCCCTGGCATTTATGG + Intergenic
1055794023 9:79955086-79955108 TGGAAGCCCCCTTCCATCACAGG + Intergenic
1056386777 9:86103103-86103125 TAGGTTGCCCCTTCCATCACAGG - Intergenic
1058046987 9:100367518-100367540 TAGGATTCCCCTTGCAGAACAGG - Intergenic
1058246432 9:102631914-102631936 GGGGATTCCCCTCCCATCACTGG + Intergenic
1058271374 9:102975821-102975843 TGAGATTGCCCCTCCATCACAGG - Intergenic
1058312623 9:103523839-103523861 TGGGATTCAACTTGTATCCCAGG + Intergenic
1062123401 9:134846524-134846546 TGGGAGTCCCCTTGCATGACGGG - Intergenic
1062541578 9:137043981-137044003 TGGGGTTCCCCTGGCTCCACTGG - Intronic
1189763771 X:44348355-44348377 TGGTATTCCCCTTTCTGCACTGG + Intergenic
1193553090 X:82923317-82923339 GGGGGTTCCCTTTGCATAACGGG + Intergenic