ID: 1169900298

View in Genome Browser
Species Human (GRCh38)
Location 20:10545849-10545871
Sequence CTAGTAATCAACATCTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169900298_1169900304 -7 Left 1169900298 20:10545849-10545871 CCAACCTAGATGTTGATTACTAG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1169900304 20:10545865-10545887 TTACTAGGGGAATATTTACAGGG 0: 1
1: 0
2: 1
3: 14
4: 154
1169900298_1169900305 -6 Left 1169900298 20:10545849-10545871 CCAACCTAGATGTTGATTACTAG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1169900305 20:10545866-10545888 TACTAGGGGAATATTTACAGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
1169900298_1169900303 -8 Left 1169900298 20:10545849-10545871 CCAACCTAGATGTTGATTACTAG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1169900303 20:10545864-10545886 ATTACTAGGGGAATATTTACAGG 0: 1
1: 0
2: 0
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169900298 Original CRISPR CTAGTAATCAACATCTAGGT TGG (reversed) Intronic
901282394 1:8048895-8048917 CTATTAAACAATATCTAGGCTGG - Intergenic
902113797 1:14104592-14104614 CTAGGATTCAAGTTCTAGGTTGG - Intergenic
906745920 1:48222160-48222182 AGAGAAAGCAACATCTAGGTAGG + Intergenic
909573806 1:77149333-77149355 CTTGTAGGCAACATATAGGTGGG - Intronic
913660578 1:121003150-121003172 CTCGGACTCCACATCTAGGTAGG + Intergenic
914011942 1:143786307-143786329 CTCGGACTCCACATCTAGGTAGG + Intergenic
914165890 1:145174827-145174849 CTCGGACTCCACATCTAGGTAGG - Intergenic
914650571 1:149694967-149694989 CTCGGACTCCACATCTAGGTGGG + Intergenic
916385915 1:164269310-164269332 CAAGTAATCAACATATATGTAGG - Intergenic
920568028 1:206991723-206991745 CTAGTAAACAATAGCTATGTAGG - Intergenic
923709473 1:236374814-236374836 CTTGTGAACAACATCTAGTTGGG + Intronic
1063780560 10:9317926-9317948 ATAGTAATCAATATTTAAGTTGG + Intergenic
1066313068 10:34217155-34217177 TTAGACATCAACATCTCGGTGGG + Intronic
1067537069 10:47119909-47119931 CTTGCAATCAACATATAGTTAGG + Intergenic
1069556813 10:69403677-69403699 CTCTTAATCACCATCTACGTGGG + Intergenic
1080614764 11:33936163-33936185 CTGGAATTCAACTTCTAGGTGGG + Intergenic
1086027977 11:82318023-82318045 CTAGTTATCAAAATCTAGCATGG - Intergenic
1086154706 11:83652872-83652894 CTAGTAATGTACAACTTGGTGGG - Intronic
1086166072 11:83780135-83780157 CTTTAAATCAACATCTATGTAGG - Intronic
1090923163 11:131225382-131225404 CTAGTAGACAACATGTAGTTTGG + Intergenic
1093999929 12:25684042-25684064 GTAGTACTGAACATCTATGTGGG - Intergenic
1097106189 12:56627080-56627102 CTAGGGATCTTCATCTAGGTGGG + Intronic
1097631980 12:62075318-62075340 ATAGTAATTAATATGTAGGTAGG + Intronic
1099580380 12:84438950-84438972 CATGTAATCACCGTCTAGGTTGG - Intergenic
1101639714 12:106579240-106579262 CAACTAATCAACATCAAGGCTGG + Intronic
1104327674 12:127815346-127815368 CTTGTAATCAAGATATAGCTGGG - Intergenic
1109004314 13:56851768-56851790 CTACTAATCAACATCTACATAGG + Intergenic
1109434256 13:62277840-62277862 CTTGTAAGCAACATATAGTTTGG + Intergenic
1110549445 13:76795733-76795755 CTGCTAATCAACATCTATGTAGG + Intergenic
1111648179 13:91057931-91057953 CTTGTAATTAAAATCTGGGTTGG + Intergenic
1112208325 13:97347381-97347403 CTTGTAATGAACATGAAGGTGGG + Intronic
1117064936 14:52003409-52003431 CTAGTAATGTAAATCTACGTAGG - Intronic
1117490509 14:56242039-56242061 CTAGCAATCAGCTTCCAGGTAGG + Intronic
1119994246 14:79234879-79234901 CTAGGAAAAAAAATCTAGGTTGG + Intronic
1131500014 15:92953123-92953145 ATAGTAATCCAAGTCTAGGTAGG + Intronic
1135657032 16:24259257-24259279 CATGTAATTAACACCTAGGTGGG + Intronic
1135956764 16:26962526-26962548 CAAGGAATGAACATCCAGGTTGG - Intergenic
1139471647 16:67181047-67181069 CCAGTAACCACCACCTAGGTGGG - Intronic
1140171062 16:72605449-72605471 GAAGTAATATACATCTAGGTTGG + Intergenic
1150495056 17:65601456-65601478 AAAGTGATTAACATCTAGGTAGG + Intronic
1154027724 18:10724169-10724191 CCAGTAACCACCATCTAGGTGGG + Intronic
925476226 2:4219103-4219125 CTAATAATCAACCTTTAAGTGGG - Intergenic
928113643 2:28529450-28529472 CTGGTCTTCAACATATAGGTGGG + Intronic
929231546 2:39565441-39565463 CTTCTAATTAACTTCTAGGTTGG + Intergenic
929275231 2:40018156-40018178 CTTGTAAGCAACATATAGTTGGG - Intergenic
933636419 2:84713451-84713473 CTTGTCATCACCATCTAGTTAGG + Intronic
935547001 2:104410886-104410908 CTAATAATCAAACTCAAGGTTGG + Intergenic
941081296 2:161063764-161063786 CTAGCAATAAACATCGAGTTGGG - Intergenic
943331086 2:186560123-186560145 CTACTGATCAAAATCTAGGCTGG + Intergenic
945005155 2:205397538-205397560 GTGGTAATAAACATCAAGGTAGG + Intronic
947113064 2:226740693-226740715 ATAGTAATAAAAATCTAGTTGGG + Intronic
947508176 2:230725935-230725957 CTAGAAATCAACACTTAGCTAGG - Intronic
948924254 2:241083774-241083796 CTAGTATTTAACATAGAGGTGGG + Intronic
1169900298 20:10545849-10545871 CTAGTAATCAACATCTAGGTTGG - Intronic
1170721185 20:18880221-18880243 CTTGTATACAACATATAGGTGGG + Intergenic
1177234592 21:18371408-18371430 CTAGAAAGCAGCATCTAAGTAGG - Intronic
952030313 3:29133640-29133662 CAAGTAATCAATATTTAGTTTGG - Intergenic
956339183 3:68202265-68202287 CTTGTAAACAACATCTAGTTGGG + Intronic
960483770 3:118226205-118226227 GTAAGAATCAACATCTAGGTAGG - Intergenic
963997213 3:151723251-151723273 CGTGTTATCAACATCTAGGCAGG - Intergenic
964611884 3:158624065-158624087 CTATTAATAAACATGTAGCTTGG - Intergenic
966575510 3:181497586-181497608 ATACTAAGCAACATCTAGCTTGG + Intergenic
966775954 3:183542741-183542763 CTGGAAATCATCATCTAGTTAGG - Intronic
974737524 4:65956709-65956731 CTAGTTAGAAACTTCTAGGTTGG + Intergenic
979207558 4:118058325-118058347 ATATTATTCAACATCTAGGTGGG - Intronic
982821764 4:159949419-159949441 TTTGTAATCAACATCAAGGCAGG + Intergenic
986659807 5:10049022-10049044 ATAGTAATTAAAATTTAGGTTGG - Intergenic
987439183 5:17934676-17934698 CTTGTAAGCAACATATAGTTGGG - Intergenic
988747885 5:34161107-34161129 CCAGTAAAGAATATCTAGGTAGG + Intergenic
989341052 5:40375938-40375960 CTAGTAATGAAGACCTAGATGGG + Intergenic
994439693 5:99786769-99786791 CTACTAAAGAACATCTTGGTTGG + Intergenic
996769928 5:127075000-127075022 CTAGTTATAAACACCTTGGTGGG + Intergenic
997396630 5:133565193-133565215 CTAGCAATGAACACCTGGGTTGG - Intronic
1003307033 6:4938969-4938991 CTAGTCATCAACATGAAAGTTGG + Intronic
1005545468 6:26864189-26864211 CCAGTAAAGAATATCTAGGTAGG + Intergenic
1006936554 6:37722858-37722880 CTAGTACTCCACATCCATGTCGG + Intergenic
1009016170 6:57904953-57904975 CCAGTAAAGAATATCTAGGTAGG + Intergenic
1012496350 6:99837333-99837355 CTAGCAAGCAACATCTTGGATGG + Intergenic
1014874957 6:126646432-126646454 GTATTAATCAACATCCAGGTGGG - Intergenic
1015205029 6:130627575-130627597 CTATTTTTGAACATCTAGGTTGG - Intergenic
1022219507 7:28298826-28298848 CCAGTGATCATCATCTTGGTGGG - Intergenic
1028223358 7:88221521-88221543 CTTGTACTCAACATCGAGTTCGG - Intronic
1030169429 7:106586645-106586667 CTGGTAATCAATGTCCAGGTTGG + Intergenic
1040640160 8:49323943-49323965 CTTGTAATTAACATATTGGTGGG - Intergenic
1040782253 8:51123411-51123433 CTAGTCATCAATATCTTGGCAGG - Intergenic
1040811414 8:51458177-51458199 CTAATATTCAACAACTTGGTAGG - Intronic
1040872169 8:52111170-52111192 ATAGTAATAAATATGTAGGTTGG + Exonic
1043605413 8:81992595-81992617 ATAGTAATCATCTTTTAGGTAGG + Intergenic
1043866136 8:85377930-85377952 ATAGTAATTAAGATGTAGGTAGG + Intronic
1045580337 8:103471743-103471765 CTATTCATGAACATTTAGGTTGG + Intergenic
1048409662 8:134159409-134159431 CTAGTAACCCACATCAAGGGAGG - Intergenic
1050883495 9:10735149-10735171 ATAGTAATCAATATCCAGTTAGG - Intergenic
1052257812 9:26479830-26479852 CTAGGAACCAACATTTGGGTTGG + Intergenic
1187021683 X:15389136-15389158 CTAGTAACTAACATTTAGGTGGG - Intronic
1187425601 X:19175015-19175037 CTAATTACCAACATCTAAGTTGG - Intergenic
1188486276 X:30685740-30685762 CTAGAATTAAACCTCTAGGTAGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1191669285 X:63734267-63734289 CTAGCCAACATCATCTAGGTTGG - Intronic
1191750128 X:64533561-64533583 TTTGGAATCAACATGTAGGTTGG - Intergenic
1193209548 X:78789735-78789757 CTAGAAATGAAATTCTAGGTTGG - Intergenic
1194971009 X:100344012-100344034 CAAGCATTCTACATCTAGGTTGG - Intronic
1199477485 X:148261069-148261091 CTTGTAAGCAACATATAGCTGGG + Intergenic
1200467545 Y:3538531-3538553 CTTATAAGCAACATGTAGGTGGG - Intergenic