ID: 1169900459

View in Genome Browser
Species Human (GRCh38)
Location 20:10547425-10547447
Sequence GAGGTGAAAAGGACTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 434}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169900459 Original CRISPR GAGGTGAAAAGGACTCAGGA GGG (reversed) Intronic
900779071 1:4605768-4605790 GAGATGAGAAGGAGTCAGGAGGG - Intergenic
901052980 1:6434940-6434962 GAGGTGTAGAGGCCTCAGGTGGG + Intronic
902481260 1:16713109-16713131 GAGGTGTAGAGGCCTCAGGGGGG - Intergenic
902847628 1:19124420-19124442 AAGGTGAAAGGGACTCTGCAAGG + Intronic
902882776 1:19383799-19383821 GAGGTGAGGAGGACTCGGGGAGG - Intronic
904555009 1:31355830-31355852 GAGGGTAAAAGGAAACAGGAGGG - Intronic
904809112 1:33151752-33151774 GAGGTCAAAGGCATTCAGGAAGG + Intronic
905926624 1:41754619-41754641 GAGGGAAAAAGGAGTCAGCAGGG + Intronic
907707346 1:56844345-56844367 GAGGCCAAAAGGAGGCAGGAGGG - Intergenic
907737368 1:57127705-57127727 TAGGTGACTAAGACTCAGGAAGG - Intronic
908230564 1:62100656-62100678 GAGGTTACAATGACTCAGAAAGG - Intronic
910050295 1:82965423-82965445 GAGGTAAAAATGACCCAGGCAGG - Intergenic
910410086 1:86934064-86934086 GAGCTAAAAAGCACTCATGAAGG - Intronic
910930549 1:92439052-92439074 GAAGTGAAAAGAACACTGGATGG + Intergenic
912069479 1:105791204-105791226 GAGGGGAAATGGCCTTAGGATGG - Intergenic
912375753 1:109208559-109208581 GAGGTGAAAAGGAAGCAGAGGGG - Intergenic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
913163112 1:116163206-116163228 GAGGTGAAAAAGACAGTGGAGGG + Intergenic
913273762 1:117118671-117118693 AGGGTGAACAGGACACAGGATGG + Exonic
913454856 1:119020371-119020393 AAGTTGAAAAGGGCTCAGGAAGG + Intergenic
914011739 1:143784861-143784883 GAGTTGAAGAGGATGCAGGATGG - Intergenic
914166094 1:145176273-145176295 GAGTTGAAGAGGATGCAGGATGG + Intergenic
914320833 1:146557969-146557991 GAGGAATACAGGACTCAGGAAGG + Intergenic
914679811 1:149931240-149931262 GAGGTGAGAATGATTCGGGATGG - Exonic
914807589 1:151002849-151002871 GAGGTGGAAAGAGCTCAGCACGG - Intronic
915889818 1:159762678-159762700 GAGATCACAAGGACACAGGAAGG + Intergenic
916819579 1:168385354-168385376 GAGGAGAAAAGGGATAAGGAGGG + Intergenic
916986955 1:170201986-170202008 GAGATGAGAAGAAATCAGGATGG - Intergenic
917271787 1:173283465-173283487 GAGGTGAAATGGTCTCAGTTTGG + Intergenic
917660604 1:177173540-177173562 GAGGAGAAAAGGGCTGGGGAAGG + Intronic
918703930 1:187638075-187638097 GAGGATCAAAGGACTCATGAGGG - Intergenic
919072327 1:192771997-192772019 GAGGTGAAATGGCATCAGAAAGG + Intergenic
920321651 1:205128165-205128187 GAGGCTTTAAGGACTCAGGAAGG - Intergenic
921289150 1:213638827-213638849 GAAATGAAAAGGACCCAGAATGG - Intergenic
922531715 1:226350070-226350092 GAGGAGAGAAGGAGGCAGGATGG - Intergenic
923208393 1:231780038-231780060 GAGGTCACATGGACACAGGAAGG + Intronic
1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG + Intronic
1063194574 10:3729512-3729534 AAGGAGAAAAGGGCTCAGAATGG - Intergenic
1063329786 10:5146149-5146171 GAGGTCACATGGACACAGGAAGG + Intergenic
1063361612 10:5463686-5463708 GGGGTGCAGAGGATTCAGGATGG - Intergenic
1067424539 10:46195365-46195387 AAGGTGGAAAGGACGGAGGAAGG - Intergenic
1067442948 10:46321523-46321545 GTGGTGACAAGGACTCGGTATGG + Intronic
1067741629 10:48899906-48899928 GAAGTGAAAAAGTCTGAGGATGG + Intronic
1068706518 10:60082245-60082267 GATATGAAAAGGACTGAGTAGGG + Intronic
1069574958 10:69520179-69520201 GAGGTTACAAGGACTGAGGGAGG - Intergenic
1070161003 10:73866722-73866744 AAGATGAAAGGCACTCAGGAGGG - Intronic
1070313429 10:75289938-75289960 AAGGTGAAGAGGTCTCAAGAAGG - Intergenic
1070329963 10:75409611-75409633 GAGGGGAACGGGCCTCAGGAGGG + Intergenic
1070365491 10:75732887-75732909 GAGCTGAAAAAGATTGAGGAGGG + Intronic
1070484007 10:76912476-76912498 GAGGTGAAATGGTCTGAGGAGGG + Intronic
1070828677 10:79405688-79405710 GAGGTGGAAAGGCCTCAGCCTGG + Intronic
1072009475 10:91290870-91290892 GAAGTGCAAAGGGCTCTGGAGGG - Intergenic
1072521346 10:96232498-96232520 GAGGTGAAATGGGGTCAGGAAGG + Intronic
1073188282 10:101630684-101630706 GAGGTCAACAGAAGTCAGGAAGG + Intronic
1073482413 10:103794887-103794909 GAGCTGAAAAGCCCTAAGGATGG + Intronic
1075199122 10:120387542-120387564 TATGTGAAGATGACTCAGGATGG + Intergenic
1075620023 10:123919850-123919872 AAGGTGAAAAGGAGGCAGGGTGG + Intronic
1076218821 10:128716821-128716843 GAGGTGAAAATGGCCCAGGACGG - Intergenic
1078405734 11:11068421-11068443 CAGAGGAAGAGGACTCAGGAAGG - Intergenic
1078575963 11:12503009-12503031 GAGGAGAAAAAGACTCAGTGAGG - Intronic
1078848786 11:15145050-15145072 GAGGTGAAAAGGACACATGTAGG - Intronic
1080782291 11:35440843-35440865 GATGTGAAGAGGAGTCGGGATGG - Intronic
1081618395 11:44603941-44603963 CAGGTGCAAAGGCCTGAGGAAGG - Intronic
1082148359 11:48700023-48700045 GAGATGACATGGACACAGGAAGG - Intergenic
1082774892 11:57237262-57237284 GAGGAGACAGGGACGCAGGAGGG - Intronic
1083420144 11:62547712-62547734 GAGGATAAAAGGACTCATGAGGG - Intronic
1085318644 11:75561445-75561467 GGGGTGACAAGGATTGAGGAAGG + Intergenic
1086002119 11:81996461-81996483 GAGCTGGAAAGGAGACAGGAAGG + Intergenic
1086964377 11:93012444-93012466 GAGGTGAAAAGTGCTAAGAACGG + Intergenic
1087751655 11:102013473-102013495 GTGGTGGAAAGGCCTCAGTAGGG + Intergenic
1087922352 11:103880869-103880891 GAGGTAAAAAGAACTTAAGATGG - Intergenic
1087938561 11:104064627-104064649 GAAGTGAAAAGGAGGAAGGAAGG + Intronic
1088707536 11:112477376-112477398 GAGCTGAGCAGGACTCAGGCTGG - Intergenic
1088767526 11:112998081-112998103 GGGTTGAAAAGGACTCAGTGAGG + Intronic
1089038812 11:115426057-115426079 CAGGTGACAAGGAGGCAGGAGGG + Intronic
1089171794 11:116517063-116517085 GAGGAAAATAGGACTCAGCAAGG + Intergenic
1089459072 11:118642214-118642236 GAGGGGAAAAGGGGACAGGAGGG - Intronic
1090719488 11:129458812-129458834 GAGTGGAAAAGGAGGCAGGAAGG - Intergenic
1091317393 11:134624170-134624192 GAGGCGCAAAGGTCTCAGGAAGG + Intergenic
1091553204 12:1552508-1552530 GGGGTGAAAAGGACGGAGAATGG - Intronic
1092006774 12:5076779-5076801 GAGGTGAAAAGGAAACAAGAGGG + Intergenic
1092648143 12:10602119-10602141 AAGGTGAATAGTTCTCAGGATGG + Intergenic
1092737469 12:11596102-11596124 GAAGTGCAAAGGAAACAGGAAGG + Intergenic
1093010569 12:14102245-14102267 GAGGTGAAATGGACTCTGTGAGG - Intergenic
1093169034 12:15838258-15838280 GAGGAGAAAAGAACTCAGAGTGG - Intronic
1093496162 12:19760776-19760798 CATGTGAGAATGACTCAGGATGG - Intergenic
1094447312 12:30545933-30545955 GGGGTGAAATGGACTCAGTGAGG + Intergenic
1094636081 12:32227932-32227954 CAGGTGAAAAGGCATCACGAAGG + Intronic
1094860815 12:34464237-34464259 GAGGTTACATGGACACAGGAAGG - Intergenic
1095648354 12:44576735-44576757 GAGGTCACATGGACACAGGAAGG - Intronic
1095828511 12:46557012-46557034 GAGGTGAAAATGACTGCTGAAGG - Intergenic
1095874436 12:47065123-47065145 TAGGTGAAACGGACTCATGGTGG + Intergenic
1097145081 12:56934488-56934510 GAGGTGACAAGGCTTCAGGTTGG - Intergenic
1097245753 12:57606834-57606856 AGGGTGAAAGGGACTCAGGGTGG - Intronic
1098212347 12:68179977-68179999 GAGTTGAAAAGCACTCCTGAAGG + Intergenic
1098580026 12:72088676-72088698 GAGAAGAACAGAACTCAGGATGG - Intronic
1099623405 12:85033665-85033687 GAGGAGAGAAAGACTCAGCAAGG + Intronic
1099811042 12:87582490-87582512 GAGGTCACATGGACACAGGAAGG - Intergenic
1100123653 12:91397336-91397358 GAGGAGTAAAAGGCTCAGGAGGG - Intergenic
1101079111 12:101163691-101163713 GAGGTGACAAGAACCCAGAAAGG + Intronic
1101336571 12:103802060-103802082 GAGGTGAGCTGGACTCTGGAGGG - Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102166594 12:110811708-110811730 CAGATGAAAATGACTAAGGAGGG + Intergenic
1102466762 12:113134872-113134894 GGGGTCAAAAGGACCCTGGAGGG + Intronic
1104793043 12:131495878-131495900 GAGAAGAAATAGACTCAGGAGGG - Intergenic
1105005130 12:132716910-132716932 CAGGTGAAAACGCCTCAGGAAGG - Intronic
1106483798 13:30155630-30155652 GAGAGGGAAAGGACTCAAGAAGG + Intergenic
1107560082 13:41550599-41550621 GAGGATGAAAGGAATCAGGAGGG + Intergenic
1107698051 13:43020080-43020102 GAGGTGAGGTGGACTCAGCAGGG - Intergenic
1108629761 13:52269831-52269853 GAGATCACAAGGACACAGGAAGG - Intergenic
1109489332 13:63075411-63075433 GAAGTCAAAAGGACTCAGCAAGG - Intergenic
1109881081 13:68477007-68477029 CAAGTGAAAAGGAGTCAGTATGG + Intergenic
1109897426 13:68711857-68711879 GAGGAGATAATGAGTCAGGAGGG - Intergenic
1111073131 13:83196345-83196367 GAGATGTAAAAGATTCAGGATGG + Intergenic
1113450815 13:110408117-110408139 GAGCAGAACAGGAATCAGGAAGG + Intronic
1114655568 14:24313523-24313545 GAGTTGAAAGGGAAGCAGGAAGG + Exonic
1114681333 14:24486353-24486375 GAGATCACAAGGACACAGGAAGG - Intergenic
1114712645 14:24794153-24794175 GATGTGAAAAGGAGTGAGAATGG - Intergenic
1116092960 14:40332010-40332032 GAGGTAACATGGACACAGGAAGG + Intergenic
1116182884 14:41557843-41557865 CAGGAGCAAAGGACTCAGGCAGG - Intergenic
1116475850 14:45338472-45338494 GAGGAGAGAAGTGCTCAGGAAGG + Intergenic
1117680204 14:58195976-58195998 GAGGTGAAAAATACACTGGATGG + Intronic
1118270229 14:64336575-64336597 GAGATGAGAAGGAAACAGGAGGG - Intronic
1121900885 14:97692480-97692502 AAGGTGGAAAGGAATCAGGGAGG + Intergenic
1123118116 14:105903882-105903904 GAAATGAGCAGGACTCAGGACGG + Intergenic
1123134258 14:106012492-106012514 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123165942 14:106324823-106324845 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123173941 14:106400140-106400162 GAGATGACATGGACACAGGAAGG - Intergenic
1123584286 15:21742935-21742957 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123620937 15:22185538-22185560 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123934114 15:25185925-25185947 GAGGAGAATGCGACTCAGGAAGG - Intergenic
1124010756 15:25836699-25836721 TAGCTGCAAAGGATTCAGGATGG - Intronic
1124409303 15:29422731-29422753 AAGGTGACAAGGACTCACAAAGG + Intronic
1124956547 15:34364096-34364118 GAGGTGAAGAAGACTGAAGAAGG + Intronic
1125349076 15:38748748-38748770 AAGGTGAGAAGGACTGAGTAAGG - Intergenic
1125960830 15:43828313-43828335 GATGTGGAAAGTAGTCAGGATGG + Exonic
1126475036 15:49056410-49056432 GAAGCTATAAGGACTCAGGAAGG + Intergenic
1126694287 15:51313067-51313089 GAGCTGAAAATGGCTCATGAAGG - Intronic
1126931148 15:53652808-53652830 GAGCTGATAAAGACTCAGAAAGG - Intronic
1127058967 15:55162526-55162548 GAGGACACATGGACTCAGGAAGG + Intergenic
1128971858 15:72115220-72115242 GAGGAGAAAAGGTTTTAGGATGG - Intronic
1129806628 15:78466453-78466475 CAAATGAAAAGGACACAGGATGG - Exonic
1129916321 15:79275979-79276001 GAGGTCACATGGACACAGGAAGG + Intergenic
1130073556 15:80669400-80669422 GTGGTGATCAGGACCCAGGATGG + Intergenic
1130106317 15:80931276-80931298 GAGGGGAAAAGGACACAGAATGG - Intronic
1130122988 15:81068384-81068406 GAGATGGAAAGGAAGCAGGATGG + Intronic
1131102656 15:89705335-89705357 TAGGTGGAGAGGACCCAGGAAGG + Intronic
1131399041 15:92110014-92110036 GAGGAGAAAGGGAATCAGGCTGG + Intronic
1131493227 15:92881051-92881073 GAGGAAAAAAGGATTCAGAATGG + Intergenic
1131654238 15:94438393-94438415 GAGAGGAATAGGACTGAGGAAGG + Intronic
1131758440 15:95592678-95592700 GCTGTGGAAAGGACACAGGAAGG - Intergenic
1133228574 16:4355181-4355203 GAGGTGGGAGGGAGTCAGGAGGG + Intronic
1133634444 16:7652339-7652361 GAGGTGAGGAGGAGTTAGGAAGG - Intronic
1133681823 16:8126926-8126948 GAGGGGATAAGGATCCAGGAGGG + Intergenic
1133997946 16:10762211-10762233 GAGGTGAAAATCCCTTAGGAAGG + Intronic
1134119617 16:11574592-11574614 GAGGCGGGAAGGACCCAGGATGG - Intronic
1134359161 16:13514550-13514572 GAGGTTAAAATTACACAGGAGGG + Intergenic
1136994775 16:35182056-35182078 GAGGTGAGGAGGACTCAGCTAGG - Intergenic
1137507701 16:49068755-49068777 GAGAAGAAAAAGACTCTGGAGGG - Intergenic
1138589032 16:57989632-57989654 ATGATGAAATGGACTCAGGAAGG + Intergenic
1138659912 16:58510793-58510815 GAGTTGAACAGGACACAAGAAGG - Intronic
1139020137 16:62738797-62738819 GAGGGGAAAGAGACTCTGGAAGG + Intergenic
1140012700 16:71152138-71152160 GAGGAATACAGGACTCAGGAAGG - Intronic
1140969625 16:80000621-80000643 GAGATGAAACGCAATCAGGATGG - Intergenic
1143266198 17:5639751-5639773 GGGCTGAAAAGGAGGCAGGAAGG + Intergenic
1144061565 17:11587396-11587418 CAGTTGAGAAGGACTCAAGATGG - Intergenic
1144111934 17:12043879-12043901 AAGGTGAAAAGGACTAGAGACGG - Intronic
1144352654 17:14412696-14412718 GAAGTTTTAAGGACTCAGGAAGG + Intergenic
1145881879 17:28357932-28357954 GATGGGAAAAGACCTCAGGAGGG - Intronic
1146572266 17:33962931-33962953 GAAGTGAAAAGAACTTAGGAAGG - Intronic
1146688384 17:34856796-34856818 GAGGGTGGAAGGACTCAGGATGG + Intergenic
1146885736 17:36469596-36469618 GAGCTGAAAAGGGGTCAGGGGGG + Intergenic
1147305044 17:39557357-39557379 TAGGAGAAAATGACCCAGGAAGG - Intronic
1147322650 17:39655772-39655794 GTGGTTACAAGGACTCAGTAGGG + Intronic
1148561609 17:48609926-48609948 GAGGAGAAAAGGACCCAGCCAGG - Intronic
1148971099 17:51482697-51482719 GAGATCACAAGGACACAGGAAGG - Intergenic
1150613823 17:66753749-66753771 GAGGGGAAGAGGCCACAGGAGGG + Intronic
1152036879 17:77879191-77879213 AAGGGGAACAGGACTCAGGGTGG - Intergenic
1152084883 17:78211917-78211939 GAAGTGAAAAGGAGTTAGGCCGG + Intergenic
1153802031 18:8679825-8679847 AGGGTGAAAGGGACTCAGGAAGG + Intergenic
1154971679 18:21416153-21416175 GAGAAGAAAAGCACTCTGGATGG + Intronic
1156931352 18:42647992-42648014 CAGGAGAAAAGAAATCAGGAAGG - Intergenic
1156972703 18:43176035-43176057 GAGATCACAAGGACACAGGAAGG - Intergenic
1157218646 18:45807461-45807483 GAGGTGAAATGGACTCTGTGAGG - Intergenic
1157938756 18:51902496-51902518 GAGGGGAAAAGAACCCAAGAAGG + Intergenic
1158077883 18:53552304-53552326 GAGGTGCAAAGGACTCTGCTGGG + Intergenic
1159986183 18:74844157-74844179 GGAGGGAAAAAGACTCAGGATGG - Intronic
1161662772 19:5557477-5557499 GAGGTGAGAGGGCCCCAGGAAGG - Intergenic
1161821607 19:6533711-6533733 GAGGGGAAGGGGACTCTGGAGGG - Intronic
1162120616 19:8464643-8464665 GAGGTGAAAAGAAGTTAAGAGGG - Intronic
1162921580 19:13906334-13906356 GAGGAGTGCAGGACTCAGGAAGG + Exonic
1163222493 19:15931497-15931519 GAGGTGAGAAAGACTTGGGATGG + Intronic
1164414888 19:28038669-28038691 GAGGGAAAAATGACTCAGAATGG - Intergenic
1164953115 19:32355740-32355762 GTGGTAAAAAGGTCACAGGAGGG + Intronic
1166864199 19:45826221-45826243 GAGCTGACAAGGACACAGGTTGG - Exonic
1167148442 19:47695752-47695774 CAGGTGATATGGACACAGGACGG + Intronic
1202715302 1_KI270714v1_random:39020-39042 GAGGTGTAGAGGCCTCAGGTGGG - Intergenic
925281084 2:2685448-2685470 GAGGTGATTAGGCCTCATGAGGG - Intergenic
926078532 2:9963615-9963637 TAGGTGGAAAGGACTTTGGAAGG - Intronic
926750732 2:16196804-16196826 TAGGTGACAAGGACTCTGGCTGG - Intergenic
929020420 2:37547283-37547305 GAGGTCACATGGACACAGGAAGG + Intergenic
929918567 2:46155869-46155891 GAGATGAGAAGGACACAAGAAGG - Intronic
930678704 2:54232529-54232551 GAGGTGAAATGGGTACAGGAAGG + Intronic
930755826 2:54970996-54971018 AAGGGGAAAAAGGCTCAGGAAGG + Exonic
931462781 2:62462879-62462901 GAGGGGCAGAGGGCTCAGGAGGG - Intergenic
931981316 2:67696371-67696393 AAGGTGAAAATGCCTCAGGGAGG - Intergenic
932708730 2:74047066-74047088 GAGGTGACAAGGCCTCAGGAAGG - Exonic
933774479 2:85763966-85763988 GAGGGGAGAAGGCGTCAGGAGGG - Intronic
933895290 2:86805817-86805839 GAGTAGGACAGGACTCAGGAGGG - Intronic
935830914 2:106999966-106999988 GAGGTGAAGAGGGGACAGGAAGG - Intergenic
936073703 2:109388021-109388043 GGGCTGAACAGGAGTCAGGATGG - Intronic
937325352 2:120986834-120986856 GGGGTTATAAGGACTCAGAATGG - Intronic
938867538 2:135438608-135438630 GAGGTGAGAAGGGATCAAGATGG - Intronic
939196783 2:138983017-138983039 GAAGTGAAAAGAACTGATGATGG + Intergenic
940802204 2:158145212-158145234 GGGGTGAAATGGACTCTGGGGGG - Intergenic
941416827 2:165231478-165231500 GAGGTTAAGAAGACCCAGGATGG + Intergenic
942188115 2:173444037-173444059 GAGGTGAAATGAATTCAGGGAGG + Intergenic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
942864734 2:180659641-180659663 GAGGTAAAATGGAAGCAGGAGGG + Intergenic
942938757 2:181591294-181591316 GAGGTGGAAATGATACAGGAAGG + Intronic
944432031 2:199644449-199644471 GGGGTGAAATGGACTCTGTAAGG + Intergenic
944928556 2:204491858-204491880 GAGGGGGAAAAGACTCAGTAGGG - Intergenic
945244678 2:207707251-207707273 GAGGAGAAAAGAGCCCAGGAAGG + Intergenic
945417989 2:209598637-209598659 GAGGTCACATGGACACAGGAAGG - Intronic
945429332 2:209746371-209746393 GAGGTCACATGGACACAGGAAGG - Intergenic
946049951 2:216854370-216854392 TTGGTGAAAAGGACCAAGGATGG - Intergenic
946345310 2:219105009-219105031 GAAATGAAAAGGACTCACCAAGG + Intronic
946601293 2:221362991-221363013 GAGGTGAAAAGGAAGCAGTAAGG - Intergenic
947938724 2:234029469-234029491 GAGGTCAATGGCACTCAGGAGGG - Intergenic
948358056 2:237396130-237396152 AAGCTGGAAAGGACTCAGGTGGG - Intronic
1168827083 20:821387-821409 GACTTGAAAGGGACTCAGAAAGG + Intergenic
1169881018 20:10346799-10346821 GAGCTGAGAAGCACACAGGAGGG - Intergenic
1169900459 20:10547425-10547447 GAGGTGAAAAGGACTCAGGAGGG - Intronic
1170460249 20:16571142-16571164 GAGGTGAACAGGTTTGAGGAAGG - Intronic
1170666913 20:18394491-18394513 GAGGTGAGGAGGAGTCAGGAAGG - Intronic
1171433855 20:25104302-25104324 GTGGTGGAAAGGACAGAGGAGGG - Intergenic
1172358113 20:34293699-34293721 GCGGTCTAAAGGACTGAGGAAGG - Intronic
1172397776 20:34621647-34621669 GGGGTAAAAAGGAGTTAGGAAGG + Intronic
1173150273 20:40561425-40561447 GAAGTGCAAAGAACCCAGGAAGG + Intergenic
1174745328 20:53056678-53056700 GAGGTGACAAGAACACAGGATGG - Intronic
1177251218 21:18593716-18593738 GAGGTGAAATGGAATTAGAATGG + Intergenic
1177770061 21:25504182-25504204 GAAGTGAGAAGGATTAAGGAAGG - Intergenic
1177783749 21:25647272-25647294 GAGAAGCAAAGGAGTCAGGAAGG - Intronic
1178379893 21:32099056-32099078 GAGGTGAGAAGGTCCCAGCATGG - Intergenic
1179261659 21:39763437-39763459 GAGATGAAAAGGAGGGAGGAGGG - Intronic
1180097417 21:45563576-45563598 GAGGTGAAAAGTACACTGGATGG + Intergenic
1180543918 22:16480765-16480787 GAGATCACAAGGACACAGGAAGG + Intergenic
1182453997 22:30438296-30438318 GAGGTAGAAAGGAATCTGGAGGG - Intergenic
1182878744 22:33714968-33714990 GAGGTGGAAAGAAATCAGGAAGG + Intronic
1182913930 22:34010535-34010557 AAGGTGAGAAAGACTCAGGGAGG - Intergenic
1182968600 22:34549872-34549894 GAGATGACATGGACACAGGAAGG - Intergenic
1183672373 22:39280486-39280508 GGGGTGGAAATGACTCTGGATGG - Intergenic
1183759764 22:39805433-39805455 GAAGTGAAAGGGCCTCAGGTTGG + Intronic
1183894883 22:40960323-40960345 GAGAGGAAAATGACTCAGGGTGG + Intronic
1184296176 22:43526951-43526973 CAGGTGTGCAGGACTCAGGATGG - Intergenic
1184935918 22:47720366-47720388 GAGATGAGAAGCACACAGGATGG + Intergenic
1185171475 22:49297106-49297128 GAGGAGACGTGGACTCAGGAGGG + Intergenic
1185276775 22:49953334-49953356 GAGCTGAGAAGGACTCAGTCTGG - Intergenic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
950324441 3:12092991-12093013 GAGAGGAAAAGTAATCAGGATGG - Intronic
950704064 3:14769296-14769318 GAGGGAAAAGGCACTCAGGAGGG + Intronic
952135240 3:30411621-30411643 GAGGTCACATGGACACAGGAAGG - Intergenic
952321198 3:32279368-32279390 GAGATCACAAGGACACAGGAAGG - Intronic
952545342 3:34413334-34413356 GAGATCACAAGGACACAGGAAGG - Intergenic
953006400 3:38983211-38983233 GGGGTGAAGAGGAATCATGAAGG - Intergenic
953905411 3:46866072-46866094 GGGGTGAACAGGAGGCAGGAAGG + Intronic
954371864 3:50173141-50173163 GAGCTGAGAAGGATCCAGGAAGG + Intronic
955013603 3:55046291-55046313 GAGGTCACATGGACACAGGAAGG - Intronic
955568706 3:60278505-60278527 GTGGTGATGAGGTCTCAGGAAGG - Intronic
957513314 3:81217938-81217960 GAGGTGATAAGGATTCTTGATGG - Intergenic
957968230 3:87348981-87349003 GGGGGGAAAAGGAATCAGAACGG + Intergenic
958200347 3:90307265-90307287 GAGATCACAAGGACACAGGAAGG - Intergenic
958202675 3:90339891-90339913 GAGATCACAAGGACACAGGAAGG + Intergenic
959802478 3:110512093-110512115 GGGGTGAAATGGACTCTGTAGGG + Intergenic
960419781 3:117429750-117429772 GAGGTGATTAGGCCTCAGGGTGG + Intergenic
961141960 3:124563303-124563325 AAGATGAAACTGACTCAGGAAGG - Intronic
962273129 3:133992784-133992806 GAGCTGAAAAGGGAACAGGAAGG - Intronic
962549860 3:136479267-136479289 GAGATCACAAGGACACAGGAAGG - Intronic
962555300 3:136544281-136544303 GAATTGAAAATGACTGAGGAGGG - Intronic
963736092 3:149019392-149019414 GAGGTGAGCAGGACTGTGGAGGG - Intronic
964654971 3:159056175-159056197 GAGATCAAATGGACACAGGAAGG - Intronic
964727225 3:159826004-159826026 GAGGTGCAAAGAAGTCAGGAGGG + Intronic
965166162 3:165196181-165196203 GAGGCGGAAAGGAGGCAGGAAGG + Intronic
965666211 3:171096279-171096301 GAGGGGGAAAGGACTGAAGACGG - Intronic
966292634 3:178378179-178378201 GAGATGCCAAGCACTCAGGAGGG + Intergenic
966579322 3:181541971-181541993 GAGATGAAAAGGTTACAGGATGG - Intergenic
967206820 3:187131175-187131197 GTGGTTAAAAGAACTCTGGAGGG + Intronic
967326501 3:188245530-188245552 GAGGTGAAAAGGCAAAAGGAAGG - Intronic
968035620 3:195544975-195544997 GGGGTGGAAAGAACTCAGGAAGG - Intergenic
969202696 4:5618375-5618397 GAGGTGAGATGGGCTCAGGCTGG + Intronic
969732245 4:8964118-8964140 GAGGTGACACGGGCTCTGGAAGG - Intergenic
970283788 4:14486615-14486637 GAGGTCACATGGACACAGGAAGG + Intergenic
970690056 4:18611849-18611871 AAGGTGAAAGGGAGTGAGGAAGG + Intergenic
972299647 4:37772753-37772775 GAGGTGGGAAGAACTCAGGGGGG - Intergenic
972858304 4:43135420-43135442 GAGGTGGAAAGGAAGCAGGGTGG + Intergenic
973378215 4:49301770-49301792 GAGATGACATGGACACAGGAAGG - Intergenic
973790450 4:54373552-54373574 GAAGTGAGAAGGACACAGGAAGG + Intergenic
973908984 4:55560249-55560271 GAGGGGAACAGGACTAAGTATGG + Intronic
974114365 4:57562507-57562529 GAGGTTACATGGACACAGGAAGG - Intergenic
975081689 4:70287713-70287735 GAGATCACATGGACTCAGGAAGG + Intergenic
975353760 4:73375292-73375314 GAGGGGAAAAGGCCGAAGGAAGG + Intergenic
976051907 4:81019666-81019688 GAGATCACAAGGACACAGGAAGG - Intergenic
976207900 4:82639674-82639696 GAGGAGGAAAGGACTATGGAGGG + Intronic
976255317 4:83093950-83093972 GAAGTGATAAGGACTCTGTATGG - Exonic
976544352 4:86317366-86317388 GAGGTGGGCAGGACTAAGGAGGG - Intronic
977347381 4:95834249-95834271 GAGCAGAAACGGACTCAGCAAGG - Intergenic
978828195 4:113049791-113049813 GAGGAGAAAAAGACCCAAGAAGG + Exonic
980204058 4:129694817-129694839 GAGATCACAAGGACACAGGAAGG + Intergenic
980251293 4:130319041-130319063 AAGGTTAAAAGGAGTCAGCAAGG + Intergenic
980926332 4:139141781-139141803 GAAGAGAAAAGGACTAGGGATGG - Intronic
981244888 4:142523847-142523869 GAGATCACATGGACTCAGGAAGG - Intronic
981527465 4:145720675-145720697 GGGGAGAAAAGGACTCCGAAGGG + Intronic
982400832 4:154966128-154966150 GAGGGGAGAATGACTCAGAAGGG - Intergenic
983310516 4:166054605-166054627 GAGATCACATGGACTCAGGAAGG - Intronic
983365040 4:166775675-166775697 CAGGTGAGAAGAAATCAGGAAGG + Intronic
984296407 4:177860383-177860405 GAGGTGTAGAGGAGTGAGGAGGG + Intronic
984308151 4:178020850-178020872 GAGGTCACATGGACACAGGAAGG + Intergenic
984359628 4:178711667-178711689 GAGCTGAAAAGGGGACAGGAAGG + Intergenic
984654034 4:182298324-182298346 GAGGTGGAAACGCCTCAGAAGGG + Intronic
985102340 4:186470865-186470887 AAGGGGAAAAGGAGGCAGGAGGG + Intronic
986082524 5:4409543-4409565 GAGGAGAATAGGAATCTGGAAGG - Intergenic
986257257 5:6110696-6110718 GAGGTGAACTGCACCCAGGATGG - Intergenic
988351855 5:30118731-30118753 GATGAGAAAAGGAATAAGGATGG - Intergenic
988886930 5:35568416-35568438 GAGGTCACATGGACACAGGAAGG - Intergenic
989183447 5:38600668-38600690 GAGAGGAAAAGGAGCCAGGAAGG - Intronic
989239978 5:39192943-39192965 GAGGTGAACAGAACACTGGATGG - Intronic
990417130 5:55597285-55597307 GAGATTAAAAAGAGTCAGGAAGG + Intergenic
990513036 5:56506378-56506400 ATGGTAAAAAGGAATCAGGAAGG - Intergenic
990612466 5:57471778-57471800 GAGATGACATGGACACAGGAAGG - Intergenic
991646415 5:68804599-68804621 GAGGAGCAAAGGCCACAGGAAGG - Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
992466078 5:77006357-77006379 TAGGTGAAAGGGAATGAGGAGGG - Intergenic
994258853 5:97633311-97633333 GAGATCACATGGACTCAGGAAGG + Intergenic
994631601 5:102295018-102295040 GAGGTGGAGAGGAGTCAAGAAGG - Intronic
995553102 5:113299884-113299906 GAGAAGACAAGGCCTCAGGAAGG - Intronic
996276128 5:121668197-121668219 GAGATCACAAGGACACAGGAAGG + Intergenic
996308409 5:122077164-122077186 AATGTGAAAAGGAAGCAGGAGGG + Intronic
996324515 5:122258030-122258052 GAGCTGTAGAGGACTCAGGAAGG + Intergenic
999554577 5:152726592-152726614 GAGGTGTTAAGGAAGCAGGAAGG - Intergenic
1000027679 5:157374290-157374312 GAGGTGAAATGTCCTGAGGAAGG - Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1001998157 5:176178661-176178683 GATGTTGGAAGGACTCAGGAAGG - Intergenic
1002655878 5:180746274-180746296 GAGGTGAAAATGAGTCAGTAGGG - Intergenic
1003065542 6:2901695-2901717 GAGATGGAAAGGAGTCAGGGAGG - Intronic
1003086643 6:3065550-3065572 GAGATGGAAAGGAGTCAGGGAGG + Intronic
1003360157 6:5418013-5418035 GAGATGAAAAATACACAGGAAGG - Intronic
1005355447 6:24978899-24978921 GATGTGAAAAGGTCCCAGAATGG + Intronic
1006213792 6:32421011-32421033 GAGGTGTCATGGGCTCAGGAGGG + Intergenic
1006250578 6:32780006-32780028 GAGGTTAAAAGAACTCAAAAAGG - Intergenic
1006593811 6:35178110-35178132 CAGGTTTAAAGGACCCAGGAAGG + Intergenic
1007217399 6:40250941-40250963 CAGGTGAAAAGACCTCAGAAAGG - Intergenic
1007823170 6:44577248-44577270 GGAGTGAAAAGGAGTGAGGACGG + Intergenic
1009798561 6:68503177-68503199 GAGGTGAAATGGACTCTGTGAGG - Intergenic
1009866967 6:69409471-69409493 GGGGTGAAATGGACTCTGTAAGG - Intergenic
1009869787 6:69439731-69439753 GAGATCACAAGGACACAGGAAGG - Intergenic
1010801099 6:80176558-80176580 GAGGTGCAAAGGTGGCAGGATGG + Intronic
1011117228 6:83906567-83906589 GAGCTGAGAAAGACTCAGGTTGG - Intronic
1011371838 6:86645344-86645366 GAGATCACAAGGACACAGGAAGG - Intergenic
1013281227 6:108638969-108638991 CAGTGGAAAAGGACTCTGGATGG - Intronic
1013358167 6:109365385-109365407 GAGGAGAAAAGGGCTGGGGATGG + Intergenic
1013624672 6:111925469-111925491 GAGGAGGAAATGAGTCAGGAAGG + Intergenic
1014137378 6:117906096-117906118 GAGGAGAAAAGGAATATGGAAGG - Intergenic
1014304780 6:119727228-119727250 GGGGTGAAATGGACTCTGTAAGG + Intergenic
1014762446 6:125371640-125371662 GAGATCACAAGGACACAGGAAGG - Intergenic
1014956094 6:127618337-127618359 GAGATCACAAGGACACAGGAAGG + Intergenic
1015598476 6:134889366-134889388 GAGGTAGAAAGGCCTCAGGATGG + Intergenic
1015831430 6:137373507-137373529 GAAGGTATAAGGACTCAGGAAGG + Intergenic
1017568549 6:155715383-155715405 GATTTAAAAAGGACTCAGAAAGG + Intergenic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1018020031 6:159753593-159753615 GAGCTTAAAAGCAGTCAGGATGG + Exonic
1019782749 7:2953811-2953833 GAGGTGGGAGGGGCTCAGGATGG - Intronic
1023551237 7:41372007-41372029 GAGTTTTAAAGGACTCAGGATGG + Intergenic
1024088673 7:45918170-45918192 GGGGTGAAAAGGACTCACTTAGG - Intronic
1024346768 7:48321768-48321790 GAGGTGAGAAGGAAGCAGCAAGG + Intronic
1026159851 7:67859299-67859321 CAGCTGAACAGGGCTCAGGATGG + Intergenic
1027695723 7:81407757-81407779 TAGGAGAAAAGCTCTCAGGAAGG + Intergenic
1027822826 7:83069854-83069876 GAAGTGAAAAGAACCCATGAGGG + Intronic
1028394036 7:90347923-90347945 CAAGTGAAAAGGATACAGGAAGG + Intronic
1030493325 7:110266083-110266105 GAGATCAAATGGACACAGGAAGG - Intergenic
1030879026 7:114853237-114853259 GATGTGAAATGGGTTCAGGATGG - Intergenic
1031220848 7:118963657-118963679 GAGATCACATGGACTCAGGAAGG - Intergenic
1032292122 7:130597960-130597982 GAGGCTGAAAGGACTCAGCATGG + Intronic
1032577017 7:133065951-133065973 GATGTGAAAAAGACTCAACAAGG - Intronic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1032941547 7:136798427-136798449 GAGATGACATGGACACAGGAAGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034562114 7:151887095-151887117 AAGGTGAGACGGACTCTGGAGGG + Intergenic
1034683147 7:152946733-152946755 GAGGTGAAATGGACTCTGTGAGG + Intergenic
1034696812 7:153060998-153061020 GATGTGAGAAGGCCTAAGGAGGG - Intergenic
1035313484 7:157984199-157984221 CAGGTGAAGAGGACTCAGGCAGG - Intronic
1035560126 8:598085-598107 GAGGGGAAAAGGCCACAGAAAGG - Intergenic
1036408424 8:8476678-8476700 GAGATCACAAGGACACAGGAAGG + Intergenic
1036828256 8:11997067-11997089 GAGGTGAAAGAGAATCAGGAGGG - Intergenic
1037082980 8:14809031-14809053 GAGATCAAATGGACACAGGAAGG + Intronic
1037264359 8:17041681-17041703 GATGTGATAAGGACCCAGGTGGG + Intronic
1037643978 8:20773519-20773541 GGGGAGAAAAGGACACAGGCAGG + Intergenic
1037678792 8:21075577-21075599 TAGGTGAAGAGGACCAAGGAGGG - Intergenic
1037773084 8:21814465-21814487 GAGGTGAAAAGAAGACAGGATGG - Intergenic
1038998415 8:32951981-32952003 GAAGTGATAAGTACTCTGGATGG - Intergenic
1039967906 8:42297100-42297122 GATGTGAACAGGTCTGAGGAAGG - Intronic
1040635623 8:49270201-49270223 GGGGTGCAATGGACTCATGAGGG + Intergenic
1040683485 8:49842220-49842242 GAGCTGAAAAGGGGACAGGACGG - Intergenic
1041378612 8:57227713-57227735 GATGTGAACAGGAGACAGGAGGG + Intergenic
1041776335 8:61527362-61527384 AAGGTGATATGGAATCAGGATGG + Intronic
1042978886 8:74503305-74503327 AAGGAATAAAGGACTCAGGAGGG - Intergenic
1043503674 8:80881570-80881592 GAGGTGAACAGGCTTCAGGGAGG + Intergenic
1044907292 8:97017971-97017993 GAGGTGAAATGGACTCTGTGAGG - Intronic
1046580456 8:116086303-116086325 GAGCCGAAAAGGGCTCAGAATGG - Intergenic
1046693418 8:117311301-117311323 TGGGTCGAAAGGACTCAGGATGG + Intergenic
1048565263 8:135589409-135589431 GAGGATGAAAGGTCTCAGGAAGG - Intronic
1049324921 8:142016882-142016904 GAGGTGTGTAGGGCTCAGGAAGG + Intergenic
1049340951 8:142112371-142112393 CAGGTGGAAAGGCCTCAGGGTGG + Intergenic
1049579824 8:143406262-143406284 GAAGTGGAAAGCACTCAGGCTGG - Intergenic
1049936702 9:506343-506365 GAGGTTAAAATGAATAAGGATGG + Intronic
1052221832 9:26033440-26033462 GAGGAGAAAAGGAATCTGGCTGG - Intergenic
1053715136 9:40879719-40879741 GAGGTCACATGGACACAGGAAGG + Intergenic
1054832960 9:69646586-69646608 GAGGTGAAAAAGAGCAAGGAAGG - Intronic
1055593342 9:77840901-77840923 GAGATGAAAGGGACACAGGTAGG + Intronic
1055700038 9:78934130-78934152 GAGAAGAAAAAGTCTCAGGAAGG + Intergenic
1055991878 9:82114948-82114970 GAGGTGAAATGGTATCTGGAAGG + Intergenic
1057114622 9:92508416-92508438 GAGGAGAAGAGTACTCTGGAAGG + Intronic
1057529594 9:95832229-95832251 AAGGTGGGAAGGACGCAGGACGG + Intergenic
1057771236 9:97969820-97969842 GAGGTGGAAAGGGCTAAGGCAGG - Intergenic
1057849720 9:98556008-98556030 GAGGGGAAAGGGAGACAGGAGGG + Intronic
1058450238 9:105089722-105089744 TAGGTGTAAAGGACTCACAAGGG + Intergenic
1059558647 9:115308971-115308993 GAGGTCACATGGACACAGGAAGG - Intronic
1060077760 9:120608713-120608735 GAGGAAGACAGGACTCAGGAAGG - Intronic
1060698618 9:125731392-125731414 GAGAGGAAAAGGAAGCAGGAGGG - Intergenic
1061682107 9:132247972-132247994 GAGGTAAAGTGGAGTCAGGAAGG + Intergenic
1061781087 9:132996425-132996447 GAAGTGAGAAGGAAGCAGGAAGG + Intergenic
1186108516 X:6230776-6230798 GAGGTGAAAATGATTAAAGAAGG + Intergenic
1187817113 X:23244334-23244356 GAGATCACAAGGACACAGGAAGG + Intergenic
1188283204 X:28296300-28296322 AAGCTGAACAGGACTCTGGAAGG + Intergenic
1188527009 X:31097733-31097755 GAGCTGAAGAGGAGGCAGGACGG + Intronic
1189720922 X:43916677-43916699 GAGATGAAAAAAACTCTGGATGG - Intergenic
1190310459 X:49113764-49113786 GAGGTGAAGTGGAATCAGCAAGG + Intronic
1190343594 X:49317267-49317289 GAGGTGAAAAGGCCTGAAGAAGG + Exonic
1190344684 X:49326794-49326816 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190345777 X:49336351-49336373 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190346881 X:49345901-49345923 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190348130 X:49536928-49536950 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190349231 X:49546484-49546506 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190350335 X:49556040-49556062 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190351437 X:49565599-49565621 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190352537 X:49575152-49575174 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190353638 X:49584700-49584722 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190354740 X:49594222-49594244 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190355845 X:49603772-49603794 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190365454 X:49689417-49689439 GAGGTGAAAACACCTGAGGAAGG - Exonic
1190452741 X:50597271-50597293 CAGGTGAAAGGGACACAGGCTGG - Intronic
1191690725 X:63935282-63935304 GAGGTGCAAAGAACACTGGATGG - Intergenic
1192866565 X:75139449-75139471 GATGTGGAAAGGATTTAGGAAGG - Intronic
1192888485 X:75362812-75362834 AAGGTGAAAAGAGCTCAGGGAGG - Intergenic
1192976748 X:76294337-76294359 GAGTTGAAAAGGTGTAAGGAAGG + Intergenic
1193293607 X:79807567-79807589 GAGATCACATGGACTCAGGAAGG - Intergenic
1194047119 X:89022153-89022175 GAGGTGCACAGTACTCAGCAGGG + Intergenic
1194631284 X:96288182-96288204 GAGGTGAAAATAATTCAAGATGG - Intergenic
1194701444 X:97119461-97119483 GGGGTGAAATGGACTCTGTAAGG + Intronic
1194741357 X:97578360-97578382 GAGATGACATGGACACAGGAAGG - Intronic
1196674073 X:118400859-118400881 GAGATCACATGGACTCAGGAAGG - Intronic
1197847736 X:130821492-130821514 GAGATCACAAGGACACAGGAAGG + Intronic
1198148715 X:133886372-133886394 GAGTAGAAAAGAACTCAGGTTGG + Intronic
1201704241 Y:16917993-16918015 GAGGTCACATGGACACAGGAAGG + Intergenic
1201888273 Y:18911469-18911491 GAGGTGAACAACACTCAGCAGGG + Intergenic
1202374535 Y:24221902-24221924 GAGGTCACATGGACACAGGAAGG + Intergenic
1202496245 Y:25448218-25448240 GAGGTCACATGGACACAGGAAGG - Intergenic