ID: 1169900515

View in Genome Browser
Species Human (GRCh38)
Location 20:10547884-10547906
Sequence CCTCCACAAAGGCCACCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 234}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169900510_1169900515 0 Left 1169900510 20:10547861-10547883 CCCAAAGGTAACAGAAGGCAGCT No data
Right 1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG 0: 1
1: 0
2: 2
3: 41
4: 234
1169900506_1169900515 21 Left 1169900506 20:10547840-10547862 CCCAGTACTAGACATTGACAACC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG 0: 1
1: 0
2: 2
3: 41
4: 234
1169900507_1169900515 20 Left 1169900507 20:10547841-10547863 CCAGTACTAGACATTGACAACCC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG 0: 1
1: 0
2: 2
3: 41
4: 234
1169900511_1169900515 -1 Left 1169900511 20:10547862-10547884 CCAAAGGTAACAGAAGGCAGCTC 0: 1
1: 0
2: 2
3: 10
4: 162
Right 1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG 0: 1
1: 0
2: 2
3: 41
4: 234
1169900505_1169900515 26 Left 1169900505 20:10547835-10547857 CCAGACCCAGTACTAGACATTGA 0: 1
1: 0
2: 2
3: 11
4: 131
Right 1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG 0: 1
1: 0
2: 2
3: 41
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169900515 Original CRISPR CCTCCACAAAGGCCACCTGG TGG Intronic
900308511 1:2022454-2022476 CCGCCACGAAGCTCACCTGGAGG - Intronic
900535754 1:3176372-3176394 CTTCCCCAAAGGCCACCTCAAGG - Intronic
910095769 1:83519917-83519939 CCTCTCCATAGGCCACCTGACGG + Intergenic
912231468 1:107797821-107797843 CCTGCACCAATACCACCTGGAGG + Intronic
912758157 1:112342142-112342164 CCTCCAGAAGGGCCATATGGAGG + Intergenic
913194937 1:116448458-116448480 TATCCACAAAGGCTTCCTGGAGG - Intergenic
913451589 1:118996500-118996522 CTTCCAGGAAGGCAACCTGGAGG + Intergenic
913649474 1:120898288-120898310 CCTCCTCAAAGGCCACCTACAGG + Intergenic
914077210 1:144365223-144365245 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914101968 1:144601282-144601304 CCTCCTCAAAGGCCACCTACAGG + Intergenic
914171661 1:145230807-145230829 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914296935 1:146335919-146335941 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914526770 1:148474769-148474791 CCTCCTCAAAGACCACCTACAGG - Intergenic
914639632 1:149592366-149592388 CCTCCTCAAAGGCCACCTACAGG + Intergenic
915872778 1:159579050-159579072 CCTGCACAAAGCCCACCTGTAGG + Intergenic
919859783 1:201731892-201731914 CCTCCACAGAGGGGCCCTGGGGG + Intronic
920101885 1:203522003-203522025 CCTCCACGGAGGCCAGCTGGCGG - Intergenic
922465707 1:225844689-225844711 GCTCCACGAAGGGCACTTGGTGG + Intronic
922892485 1:229072573-229072595 CCTCCACACAGGGCAGCCGGGGG + Intergenic
923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG + Exonic
1063428351 10:5966702-5966724 CCTCCAGATAGGCCCCCTGCAGG + Intronic
1065762105 10:28991929-28991951 TCTCCGCAATGGCCACCAGGAGG - Intergenic
1067039111 10:42939702-42939724 CCTCCACCACGGCCACCCAGAGG + Intergenic
1069863158 10:71483701-71483723 CCACCACACAGGCCACTAGGAGG - Intronic
1069907760 10:71741876-71741898 CCTCCACAGTGGCCACCAGGTGG - Intronic
1072614049 10:97037872-97037894 CCTCCACATAGGCCACACGATGG + Intronic
1075800697 10:125151873-125151895 CCAGCACAAAGGCCAGCGGGAGG + Intronic
1075841498 10:125508543-125508565 CCTCCAAATAGGCCTCCTGATGG + Intergenic
1077131907 11:977256-977278 CCATCCCAAAGGTCACCTGGGGG - Intronic
1077598561 11:3556166-3556188 CCTCCAAAAAGGACAGCTGGTGG + Intergenic
1078516714 11:12028707-12028729 CCTCCACCAAAGCCACCTCTTGG - Intergenic
1079350636 11:19689046-19689068 TCTCCACAAAGAGCTCCTGGAGG + Intronic
1084039199 11:66531685-66531707 TCTCCACAAAGGTCTCCAGGGGG - Exonic
1084254643 11:67932038-67932060 CCTCCAAAAAGGACAGCTGGTGG + Intergenic
1084375667 11:68775390-68775412 CCTCCGCATAGCCCAGCTGGAGG + Exonic
1084818230 11:71663849-71663871 CCTCCAAAAAGGACAGCTGGTGG - Intergenic
1085038641 11:73314155-73314177 CCTCAACAGAGGCCACCAGGAGG - Intronic
1086169143 11:83815763-83815785 CCTGCACACAGGCCTCATGGGGG + Intronic
1087291341 11:96323838-96323860 CCTCCACACAGCCCTCCAGGTGG + Intronic
1088066500 11:105726421-105726443 CCTTCGCACAGGGCACCTGGGGG + Intronic
1089226496 11:116927369-116927391 CTTCAACACAGACCACCTGGTGG - Exonic
1089698020 11:120227683-120227705 CCTCCACACAGGGGACCTGAGGG - Intronic
1089861550 11:121594672-121594694 CCCCCAAAAAGGCCATTTGGAGG - Intronic
1091812829 12:3414345-3414367 CCTCCAGAAGGGACACCTGCTGG + Intronic
1092424712 12:8365517-8365539 CCTCCAAAAAGGACAGCTCGTGG + Intergenic
1093036439 12:14336390-14336412 CCTCCACTGAGGTCACCTGTTGG - Intergenic
1094441729 12:30485477-30485499 CCACCACCAAGGCACCCTGGGGG + Intergenic
1095378765 12:41563788-41563810 CTCCCACATAGGCCATCTGGTGG - Intronic
1095834926 12:46627547-46627569 CATTCACAAAGGCCACATGGAGG - Intergenic
1096470423 12:51872012-51872034 CCTGCACAAAGGCCTTCTTGAGG + Intergenic
1097365640 12:58709519-58709541 CCACAACAAACGCCACCTGTAGG - Intronic
1098045743 12:66398543-66398565 CCTTCAGAAAGGCTTCCTGGTGG + Intronic
1099183289 12:79491893-79491915 CCTCCACCAAGATCACCTGTTGG + Intergenic
1102443836 12:112986377-112986399 CTTCCAAACAAGCCACCTGGGGG - Intronic
1103537166 12:121641034-121641056 CCTCCACCATTGCCACCTGCGGG - Exonic
1103907604 12:124335507-124335529 GCTCGACAAGAGCCACCTGGAGG - Exonic
1104014429 12:124952693-124952715 CCTCCCCAGAGGCCACCAGCAGG + Intronic
1104364903 12:128168011-128168033 CCTCCCCAAAGTGCTCCTGGGGG + Intergenic
1104681136 12:130752742-130752764 CCTGCACAAGGGCCTCCTGAGGG - Intergenic
1106542449 13:30702184-30702206 TCTCCAGAACGGCCACCTGGTGG + Intergenic
1112126175 13:96470892-96470914 CCTCCACAATGTCCTCTTGGAGG - Intronic
1113494098 13:110714179-110714201 CCTCCACATAGTTCACCAGGTGG - Intronic
1114054723 14:18957546-18957568 ACACTACAGAGGCCACCTGGAGG - Intergenic
1114080586 14:19199369-19199391 CCTCCTCAAGGGCCACAGGGTGG + Intergenic
1114107833 14:19444386-19444408 ACACTACAGAGGCCACCTGGAGG + Intergenic
1118569667 14:67180889-67180911 GCTCCACAAAGGCGAGGTGGTGG + Exonic
1118930258 14:70234461-70234483 CCACCTCCCAGGCCACCTGGGGG - Intergenic
1119767766 14:77201153-77201175 AATCCACAAAGGCTGCCTGGAGG - Intronic
1121559606 14:94864789-94864811 CGTCCCCAAAGGCCACGTGGTGG + Intergenic
1121665306 14:95667472-95667494 TCTGCACAAAGGGCACCTGCTGG + Intergenic
1121693748 14:95895922-95895944 CCAAGAAAAAGGCCACCTGGTGG - Intergenic
1121776930 14:96597607-96597629 CCTCCACAAAGACCTCCCTGGGG + Intergenic
1122276047 14:100591325-100591347 GGTTCACCAAGGCCACCTGGGGG + Intergenic
1122319561 14:100845606-100845628 CCTCCACGAGGTCCGCCTGGCGG - Intergenic
1123934445 15:25187342-25187364 CCTCCACAGACACCATCTGGGGG - Intergenic
1125523889 15:40363676-40363698 CCTCCACAGCTGCCCCCTGGAGG + Exonic
1127969703 15:63948696-63948718 CCTCCACACACGCAACCTAGAGG + Intronic
1128185152 15:65638361-65638383 CCTCCTCAAAGGCCATCTAGAGG - Intronic
1129458566 15:75688640-75688662 CCTCACCACAGCCCACCTGGAGG - Exonic
1129725227 15:77898232-77898254 CCTCACCACAGCCCACCTGGAGG + Intergenic
1130044311 15:80431814-80431836 CTTCCTCAAAGACCCCCTGGTGG + Intronic
1130273276 15:82463438-82463460 CCTCACCACAGCCCACCTGGAGG + Intergenic
1130465627 15:84190809-84190831 CCTCACCACAGCCCACCTGGAGG + Intergenic
1130487064 15:84404011-84404033 CCTCACCACAGCCCACCTGGAGG - Intergenic
1130498638 15:84482727-84482749 CCTCACCACAGCCCACCTGGAGG - Intergenic
1130587917 15:85195404-85195426 CCTCACCACAGCCCACCTGGAGG + Intergenic
1131437605 15:92435739-92435761 CCTCTTCAGAGGCCTCCTGGTGG + Intronic
1131512473 15:93056889-93056911 CCCCCACAAAGGCCACAGTGGGG + Intronic
1132409277 15:101564536-101564558 GCTACAAAAAGGCCATCTGGAGG + Intergenic
1132604339 16:787514-787536 CCTCCACAGACGCCACCGTGGGG + Intronic
1132654647 16:1036720-1036742 CCTCCACCAAGGCCCCTCGGGGG - Intergenic
1132684050 16:1154848-1154870 CCGCCCCCAAGGCCACCTGCTGG - Intronic
1132937165 16:2486981-2487003 CCTCCTCCAGGGCCACCAGGGGG + Intronic
1133269302 16:4602700-4602722 CATCCTCACGGGCCACCTGGGGG + Intergenic
1133279954 16:4659575-4659597 CCTCACCAAAGGCCCCCTGGCGG - Intronic
1133373533 16:5264514-5264536 CCGCCAAAAAGGACAGCTGGTGG - Intergenic
1133525607 16:6602535-6602557 CTTACAGAAAGGCCACCTGCAGG + Intronic
1133813484 16:9178884-9178906 CCTCCAGGAAGGGCACCTGGAGG - Intergenic
1135381465 16:21999668-21999690 CCTTCAGTAAGCCCACCTGGGGG + Intronic
1136545628 16:30953178-30953200 CCTCCACCATGGCCACCTGCAGG - Exonic
1137446321 16:48534726-48534748 CCTCCGCAGAGGCCAAATGGTGG + Intergenic
1138332946 16:56229887-56229909 CTTCCACAAAAGCTACTTGGTGG - Intronic
1138353032 16:56356574-56356596 ACACCACAGACGCCACCTGGCGG + Intronic
1138389598 16:56660708-56660730 TCTTCACAAAGGGCACCTGCGGG - Intronic
1139602120 16:67993304-67993326 CCTCGATTCAGGCCACCTGGCGG + Exonic
1140835591 16:78791081-78791103 CCTCCACACAGGGCCCCTGAAGG + Intronic
1141755121 16:85985904-85985926 CCTCCACACCGACCACCTCGTGG - Intergenic
1141951885 16:87344907-87344929 CTTCCCCAAACCCCACCTGGGGG + Intronic
1141967126 16:87453118-87453140 CCTCCAGCAAAGCCACCTGCTGG + Intronic
1142232451 16:88906176-88906198 GCTCCACCAAGGCCAACTGCAGG + Intronic
1142291053 16:89193699-89193721 CCTCCACCAGGGCCACCCGAGGG + Intronic
1142505108 17:358135-358157 GGTCCAGAAAGGCCTCCTGGTGG - Intronic
1142670603 17:1485888-1485910 CCTCCACCAACCCCACCTGGAGG - Intronic
1144547879 17:16215069-16215091 CCTCCGCACAGGACACCTCGGGG + Intronic
1145796844 17:27660562-27660584 CCACCAGACAGGGCACCTGGAGG - Intergenic
1146836447 17:36114684-36114706 CCTCCACTGAGGTCACCTGTTGG - Intergenic
1149414812 17:56448206-56448228 CCTCCAGAAAGGAAAACTGGAGG + Intronic
1150158102 17:62870981-62871003 CCTTGCCAAAGGTCACCTGGGGG - Intergenic
1151166709 17:72209946-72209968 CCTGCACACATCCCACCTGGGGG + Intergenic
1152209857 17:78997318-78997340 CCCCCACAAAGGACACCGGCTGG - Exonic
1152434653 17:80268468-80268490 CTTCCACAAAGGCCAAATAGGGG - Intronic
1152750525 17:82060506-82060528 CCTCCACCAAGGACACCGAGGGG + Intronic
1152871496 17:82755994-82756016 AGGCCACACAGGCCACCTGGAGG - Intronic
1156520009 18:37714090-37714112 CCTCCACAATGGCCGCCTTCAGG + Intergenic
1157770438 18:50340426-50340448 CCACCACGCAGGCCAGCTGGAGG + Intergenic
1159072197 18:63637886-63637908 CCTCCACAAAGGCCTTGTGTAGG + Exonic
1159073666 18:63655824-63655846 CCTCCACAAAGGCCTTGTGTAGG + Exonic
1161245392 19:3249055-3249077 CCACCACACAGCCCAGCTGGCGG + Intronic
1161399113 19:4059763-4059785 CCCCCACCTAGGCCTCCTGGAGG + Intronic
1163195901 19:15719875-15719897 CCTCCAGAAAAGATACCTGGGGG - Intergenic
1164880423 19:31728129-31728151 CCTCCAAACACCCCACCTGGAGG - Intergenic
1165327897 19:35124914-35124936 CCCCATCAAAGGCAACCTGGGGG - Exonic
1165357031 19:35310679-35310701 TCTCCAAAAAGGGGACCTGGTGG + Intronic
1165793144 19:38504378-38504400 CCTCCACATAGGCCATTTTGGGG - Intronic
1165889272 19:39100847-39100869 CCTCCACCCAGGTTACCTGGAGG - Exonic
1165937327 19:39397380-39397402 CCACCCCAAGGGCCAGCTGGGGG - Intronic
1166396020 19:42441711-42441733 TCTCCCCAAAGGCCACTTTGAGG - Intronic
1168161448 19:54513035-54513057 CCGCCCCCAAGCCCACCTGGAGG + Intergenic
925568718 2:5285908-5285930 GCTCCATAAAGGACACCAGGTGG + Intergenic
926229565 2:10992408-10992430 CCTCTACACAGGGCATCTGGGGG - Intergenic
926760563 2:16275252-16275274 CCTCCACAAAATTCCCCTGGAGG + Intergenic
926881872 2:17554171-17554193 CCTCCTCAAATGCCAACTGGAGG + Intronic
927513355 2:23658190-23658212 CCTCCACCAAGGCCAGCTCCAGG + Intronic
932673161 2:73755582-73755604 CCTTCCCCCAGGCCACCTGGAGG + Intergenic
934136371 2:88999924-88999946 CCTGCATAAAGGCCACTTGAGGG - Intergenic
935610853 2:105024266-105024288 CTTCCAGGAAGGCCAACTGGGGG - Intergenic
936012425 2:108933544-108933566 CCTTCCCCAAAGCCACCTGGAGG - Intronic
936114551 2:109691568-109691590 CCTCCAAAAAGGGGACTTGGGGG + Intergenic
936119143 2:109726480-109726502 CCTTCACAAAGGGATCCTGGAGG - Intergenic
936738508 2:115475492-115475514 CCTCCACATTGGCTTCCTGGAGG - Intronic
937324636 2:120983168-120983190 CCTCCCCAAAGGCCATCATGAGG + Intronic
937985918 2:127638034-127638056 CCTCCACCCTGGCCTCCTGGGGG - Intergenic
938472733 2:131580423-131580445 ACACTACAGAGGCCACCTGGAGG - Intergenic
941923389 2:170873379-170873401 GCTCCACAGACGCCACCTAGTGG + Intergenic
945293492 2:208147765-208147787 CCTCCCAAAAGGCAACCTTGAGG - Intergenic
946862440 2:224013369-224013391 ACCCCAGAAAGGCCACCTGAAGG - Intronic
947324374 2:228958650-228958672 GCTCAACAAAGGCCACCAGCAGG + Intronic
948232167 2:236356473-236356495 CTTCCCCAGAGGCCAGCTGGGGG + Intronic
948232277 2:236358847-236358869 CTTCCCCAGAGGCCAGCTGGGGG - Intronic
1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG + Intronic
1170838143 20:19902503-19902525 TCTTCTCAAAGGCCACCAGGAGG + Intronic
1171060710 20:21956754-21956776 CATCCACACATGCCACCTGTGGG - Intergenic
1171408918 20:24933303-24933325 CCTCCACCAAGGGCACCAGGGGG - Intergenic
1173366614 20:42391530-42391552 CCATCACAGAGGCAACCTGGAGG + Intronic
1174271814 20:49374860-49374882 CCTCCACGTGGGCCAGCTGGGGG + Exonic
1175197385 20:57253647-57253669 CCACCACAAAGAGCAGCTGGTGG + Intronic
1175286542 20:57840555-57840577 TCTCCACAAAGACCACCTCCTGG - Intergenic
1175368499 20:58471226-58471248 CCTCCACCAAGGAGCCCTGGGGG + Intronic
1175412098 20:58777174-58777196 TCTCCACCAAGTACACCTGGTGG - Intergenic
1175940891 20:62537054-62537076 CCTCCACACAGGCCTCCTCCTGG - Intergenic
1175957267 20:62617820-62617842 CCTGCCCCAAGGCCACCTAGGGG + Intergenic
1176896246 21:14382732-14382754 CCTCCACAAAGGGGTCCTGGAGG + Intronic
1178930426 21:36813984-36814006 CCTCCCCTAAAGCCACCTGGTGG + Intronic
1179501990 21:41815870-41815892 CCCCCACGCAGCCCACCTGGGGG + Intronic
1179973100 21:44847205-44847227 CCATCACAAAGGCCACCGTGCGG - Intergenic
1179981228 21:44897001-44897023 CATCCACAGAGACCACCTGCTGG - Intronic
1180115919 21:45704954-45704976 CCTCCACAGAGCCCATCTTGGGG + Intronic
1180199455 21:46215778-46215800 CCTCCACATAGAGCTCCTGGTGG + Exonic
1180473191 22:15679938-15679960 ACACTACAGAGGCCACCTGGAGG - Intergenic
1181568282 22:23752556-23752578 CCCCCACCATGGCCCCCTGGGGG - Intergenic
1181766247 22:25094326-25094348 ACTCCACAAAGCCACCCTGGGGG - Intronic
1181890248 22:26056459-26056481 CTTCCACAAAGGAGACCTGTTGG + Intergenic
1183306642 22:37086382-37086404 CCTCCACCACGGGCTCCTGGCGG + Exonic
1185023579 22:48394919-48394941 ACTCCACCAAGGCAGCCTGGAGG - Intergenic
950407338 3:12813003-12813025 CCTCCACCAGGGGCACCAGGCGG - Exonic
950751887 3:15135683-15135705 CCTCCAAAAAGGACAGCTGGTGG - Intergenic
954745510 3:52785387-52785409 CCTCCACACAGGCATCCTGGGGG + Intronic
955289278 3:57675940-57675962 GTGCCTCAAAGGCCACCTGGTGG + Intronic
957068725 3:75548621-75548643 CCTCCAAAAAGGACAGCTGGTGG + Intergenic
960592814 3:119381698-119381720 CCACCACACAGGCCGCCTGGAGG - Intronic
961284687 3:125791700-125791722 CCTCCAAAAAGGACAGCTGGTGG - Intergenic
961664853 3:128488714-128488736 CCTCACCAGAGGCCACCTCGGGG - Intronic
965007361 3:163043279-163043301 GCTCCTCATAGGCCACCAGGTGG - Intergenic
965620028 3:170633874-170633896 CCTCCAGAAAGCCCCACTGGAGG - Intronic
966209443 3:177437724-177437746 CCTCTTCCAAGGCCACATGGTGG + Intergenic
967023797 3:185546275-185546297 CCACCACAACTGCCACCTGCTGG - Intronic
967667988 3:192197642-192197664 CCTTTACAAAGCCCTCCTGGGGG + Intronic
968686022 4:1959361-1959383 CTTTCTAAAAGGCCACCTGGAGG + Intronic
969013053 4:4083162-4083184 CCTCCAAAAAGGACAGCTGGTGG + Intergenic
969740791 4:9024632-9024654 CCTCCAAAAAGGACAGCTCGTGG - Intergenic
969800129 4:9557464-9557486 CCTCCAAAAAGGACAGCTGGTGG - Intergenic
972342255 4:38162554-38162576 GCTCCACAAAGGCCTCCAGCTGG + Intergenic
973784163 4:54319507-54319529 TCTGCCCAAAGGCTACCTGGGGG - Intergenic
974402837 4:61426949-61426971 CTTCCACAGGGGCCACCTCGTGG - Intronic
974784308 4:66597643-66597665 CACCCACACATGCCACCTGGGGG + Intergenic
976047137 4:80964217-80964239 TCTGCACAAAAGCCACCTGCAGG - Intergenic
977930312 4:102743112-102743134 CCTCTGCCAAGGCCACCTGTTGG + Intronic
978606613 4:110487142-110487164 CCTCCACAAATTCCTCATGGGGG - Intronic
980009797 4:127581972-127581994 CTTCCACTAAGACCACATGGTGG - Intergenic
980707997 4:136524345-136524367 CCTCTGCCAAGGCCACCTTGTGG + Intergenic
982297635 4:153846329-153846351 AGTCCACAGAGGCCTCCTGGTGG - Intergenic
983263792 4:165486270-165486292 CCTCCATAAAAGCAATCTGGTGG + Intronic
983949871 4:173627396-173627418 CATCCACCAAAGCCACCTGCAGG - Intergenic
985416096 4:189737129-189737151 CCTGCACATTAGCCACCTGGCGG + Intergenic
985522030 5:378374-378396 CAGCCCCAAAGGGCACCTGGTGG - Intronic
985970494 5:3374280-3374302 CATCCACAAAGGTCTCCTTGTGG - Intergenic
986138737 5:5009138-5009160 CATCCACAAAGGACTCCTTGAGG - Intergenic
989980760 5:50641584-50641606 CCTCCTCAAAGGCCACCTACAGG + Intergenic
997646432 5:135485036-135485058 TCTGCCCAGAGGCCACCTGGGGG - Intergenic
997905129 5:137808783-137808805 TCTCCACACAGGCCACCTGGTGG - Intergenic
999571648 5:152925900-152925922 CCTCCACAGAGTCCCCATGGGGG + Intergenic
1002821009 6:724595-724617 CCTCCACAATGGCTAACTGCTGG - Intergenic
1003695803 6:8405442-8405464 CCTCCACTGAGGTCACCTGTTGG + Intergenic
1005080536 6:21952620-21952642 CCTTCAGAAAGGACTCCTGGAGG + Intergenic
1006414613 6:33896052-33896074 CCTCCCCAGAGGCCAACTGATGG - Intergenic
1006445289 6:34076583-34076605 CCTCCACCAAGGCCAGCTGACGG - Intronic
1011603617 6:89081441-89081463 ACTCCCCAACGGCCCCCTGGCGG - Intronic
1012393490 6:98769721-98769743 TCTCCACAACCCCCACCTGGGGG + Intergenic
1013173154 6:107655445-107655467 CACCCACAAAGGCCAGATGGTGG - Intronic
1013429201 6:110040847-110040869 CCACCAAACAGGCCATCTGGAGG - Intergenic
1016843630 6:148548723-148548745 CCTCCAGAAAAGCCCCCTCGAGG + Exonic
1017979280 6:159385395-159385417 CCTCCACAATGGCCACTTTCAGG - Intergenic
1018170430 6:161139605-161139627 CCTCCTGAAAGGCATCCTGGGGG + Exonic
1019787569 7:2987132-2987154 CCTCCACAAATCCCACCTCATGG + Intronic
1020136923 7:5592800-5592822 GCTCCACAAAGCCCAGCTAGCGG - Intergenic
1020276420 7:6627382-6627404 CCTCCCCACGGGGCACCTGGTGG + Intergenic
1023045826 7:36209396-36209418 CCTCCTCACAGGGCACCAGGTGG - Intronic
1024005177 7:45219965-45219987 GCTCCACAAAGGCCAACGTGTGG - Intergenic
1024974428 7:55100278-55100300 ACTTCACAAAGGCCTCCTTGGGG + Intronic
1027054165 7:75038746-75038768 GCTCCTCAAGGGCCCCCTGGTGG - Intronic
1029071710 7:97904795-97904817 CCTCCAAAAACGACAGCTGGTGG + Intergenic
1029437942 7:100573180-100573202 CCACCTCCCAGGCCACCTGGGGG + Exonic
1029450839 7:100641156-100641178 CCCCCGGAAAGGGCACCTGGAGG - Exonic
1029597073 7:101543589-101543611 CCTCCTCGGAGGCCACCTGTTGG + Intronic
1029732297 7:102446506-102446528 CCTCCACCATGGCCACCTGCGGG - Exonic
1033078111 7:138268302-138268324 CCTCCACAAATGGCACCAGCAGG + Intergenic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1034281602 7:149858835-149858857 CCTTCACAAAGGCCAGCTGTGGG + Intronic
1034343618 7:150372645-150372667 CCGCCACAAACCCTACCTGGCGG + Exonic
1035361051 7:158314688-158314710 CCTCCACAAAGCCAAACTGCGGG - Intronic
1036245995 8:7117199-7117221 CCTCCAAAAAGGACAGCTGGTGG - Intergenic
1036254802 8:7197263-7197285 CCTCCAAAAAGGACAGCTGGTGG + Intergenic
1036362685 8:8090244-8090266 CCTCCAAAAAGGACAGCTGGTGG - Intergenic
1036888276 8:12576828-12576850 CCTCCAAAAAGGACAGCTGGTGG + Intergenic
1036926380 8:12909736-12909758 CCTCCTCCAGGGCCTCCTGGGGG + Intergenic
1040912031 8:52529122-52529144 CCTCCACTATGGTCACCTGTTGG - Intergenic
1041313990 8:56542958-56542980 CATCCACACAGGCTTCCTGGAGG - Intergenic
1041317732 8:56581915-56581937 CCTGCTCAAAAGCCTCCTGGGGG - Intergenic
1041853410 8:62419849-62419871 CAACCACAAAGGCCATCTCGAGG + Intronic
1048256073 8:132906244-132906266 CCTGCAGGAAGGCCACCAGGTGG + Intronic
1050702209 9:8353303-8353325 CCAACACAAAGGCCTGCTGGAGG - Intronic
1056100403 9:83295392-83295414 CCTCTAAAAACTCCACCTGGAGG + Intronic
1056383616 9:86077658-86077680 CCTCCACAAAGACCACCTTGGGG + Intronic
1057355881 9:94331063-94331085 CCTCCACAGTGGCCACTGGGAGG + Intergenic
1057651875 9:96926566-96926588 CCTCCACAGTGGCCACTGGGAGG - Intronic
1060468867 9:123930650-123930672 CCTACAGGAAAGCCACCTGGGGG + Intergenic
1061189632 9:129074706-129074728 CCACCACAAAGGCCGCCTATTGG - Intergenic
1062430136 9:136523249-136523271 CCTCCCTTCAGGCCACCTGGAGG + Intronic
1187405367 X:18999273-18999295 CCTCCACAAACTCCAGCTGCTGG - Exonic
1190065844 X:47241312-47241334 CCTCAACAACTGCTACCTGGAGG + Exonic
1190375117 X:49781763-49781785 CCTCTACAGAAGCCACTTGGTGG + Intergenic
1192297621 X:69867323-69867345 CCTCCACTGAGGTCACCTGTTGG + Intronic
1192587047 X:72327475-72327497 CCTCCCCAAAGGAAAACTGGTGG + Intergenic
1193833044 X:86310811-86310833 CCTCCACTGAGGTCACCTGTTGG - Intronic
1198211830 X:134523371-134523393 CCTCCCCAAAGGCCAACTGTAGG - Intergenic
1201584733 Y:15548251-15548273 CCTCCAAGATGGCCACCTGTGGG - Intergenic
1202369607 Y:24187918-24187940 CCTCACCACAGCCCACCTGGAGG - Intergenic
1202501178 Y:25482199-25482221 CCTCACCACAGCCCACCTGGAGG + Intergenic